Description :
From Genome Similarity Track
Location :
Scaffold_413:25684- 29013
Transcript NameFunction/comments
Phyta_totarag8068hypothetical protein PHYSODRAFT_558663
Phyta_totarag8069hypothetical protein PITG_14724
Phyta_totarag8070hypothetical protein PHYSODRAFT_286191

Sequence
3329 bases(100 bases per row)
AGCTCGCTGATCCTGGCATCTCCGTTTGTATTCCTCGTTGCTTGATGCATTAATTGATTCCACTGTTGTAGGCTACGGCAAGTAGCATTATGTTGGATGA
AAGTCAAAAGCTTACTACAGTACTACTCGATGCCATTCCAACACACAACTCAAACATCCCAAGAAATCGACTTCCAAATACAAAAGTTTAGAAGTAGAAA
AcaaatacttgaagtaacGTTCATGCAAGTCACCAAACTTGCCTACATGTTGAACAAAGAGTGATCTAAGCCTCGTGCGCCGCGTGTAGTAGTATTAGAT
GGTGTTTTCATCGCAgagcaggaactcggcgtCGTTCTCCGTGGGACAAAAGAGCGCCTTCCCTGTAGTGTACGTGATGTAGCATAGCAAACCACAACGA
CCACACTAGCAGCTACCTGCTCGTACACTAGGACGTGCTTCACGCCTTAAACAGGTAAAAAAAATCGGCAACAGGATGCAGTTCATTGTGATGCAGGAAG
CCCCAACGAAGTCGGCGAACTCCGATAAGTGGTCCTGCAAGACAATAGCCAGAATCAccaagatgacgacgatgacaatgCGGAGAGCGACGTATTTGAG
CACGTTATACCGGTGTACTCGgcagcctcttcctcctcgttgTCCTTGTCCACACGCTTCGAGTCAGCCACCGGGGCATACGACATCTTAAAGCGGCGGT
TCGAGTGGAGCACCGAGTTGGTGGTGTTCGAAAAGCCTGCATCTGACTGCTTCGCCAGGTCGTCGACAGGCGTAGCGTTATCCTCGAAGCCAAAGCCATT
TCCCATACTCTCCGCTATCCTCTCGATCATGCCCAGGAACGAACGCTCGAAGATGTACTGTTGAAGGCCGGGTTCGGGATGACATGTCTGCACCTCAGTC
ACCAaagatgtagccatttcatCCAGAGCACTCTTCTGCATGGAAAGCCCACTTCACCACTTGTGCATTATAATACCCTACTTCTCCTTAGCTTCTGCAA
TGATTTTTTTCTTCCTCGTGATTgccgtgagcagcttggGGTCATTTTGCAGCACTCGGTACACGTTCAGGGCGTCACGGCCCTCCTTCAAGTGCGTCTG
GATGCGCGCGGCCTTGTGCTCATGCTGTCTcagactcagcagctccCTCGCGTTGTACTGCAGTTTGCGGCCTATGCTGCGCTCAGGGAAGCATCTCGCC
ACGCGCAGCACGTCTCGGTAGAGCGCCAACACCTCGCGCCTCAGGCCAATGCCCGTCATGTTCGTCGCTGCGTCCGTCCGATTGGCCGATAAATCGACAA
TAAATAGTTGTGATTGGCGGATAGTGCCTAAAGTGGGACGTTAGCCCATCATCCTGCCAAGAAAAACATGGTGGTCTCCAATATCCGCAGAACCGAAAGT
GGCCTCTGCGGCTCAAAAGGCTTAATCGAGACCGTGCTATTATCCAGTCAAACATGAAGAATTTCTGCCAGTTCATCGCCGTGTTCCTGGTTCTGTTGGG
GTTCATTGGCTTTGACTATGGAGTTGaagctcgtcgtgctgcgGGGATCTTCCGGGCCGACACGTTCCGACTCGCGGAGACGGAAGACTTGTGAGTTTTT
GTTATAGTTGAAATGGATAGAGTTTATtctgttggtgctgtagtgTTTTAAATGCTATGGTGATGGGTGGCAGGTATTGGGGAGCGAGTCCTGCGCAGCA
TGCGCGGCAGTTGGTGCACGACAATGTGTGggcgacgctgtcgacgaTTTCGGTGCAGTTCACTGGAATTCCCTACGGTAGTACCGTGTCATACAGCGGT
ACGTCGCTGGGAGTTGGTAATAGGATGATGGTGTATTGCGAGTATTGACTTGTATTTTTGTGTTTAGATGGTGTTGGGTACTCGAAAGAAGACTCGACAG
GCAAAATCTTCTTCTACATCACACCGATGGATGCTGCAGGTACGAGTTCAAGTGAAAGAAAAGTTAGGTTTGAGGACTAAGTTACTGATTTCTACTGTAG
GAGCGGATTTGAGTGTCAACTCGACTGCGTCGGTGGCGATCACAATGGCGCAGGAGGGGGAGCACGCGTGCAAGATGGATGTTGAAGACCCTACATGCTG
GAAACTCACTTTGACCGGGACGGTTGCGCCTGTCCCTGCGGACCAGCGTCACTACGCTGAAAAGGTGTTGTTCTCCAAGTACGTCTTATAGATCTTATAG
TGTGTGATGTCGTGTACTGTAGTGTTTTACTAATGGGGTTGGCGTTGTTTTTGGACTTGTTGCAGGCACCCACAGATGGAATACTGGCCGGAGAAGCATG
GATTCCTGCCGTACGTTCTTGATATTGAGAACATCATTCTGCTCGACTTTTACGGCGGCGCCAAGCACGTCCCAGTGAAGGAGTACTACCAGATCAAGCT
GTGAGCTGGTCCAATGCAGCAAGATTTGGTTCAGAATTGGGGAAACGCGGTTTAGTCGCGGTGGAAACATTATTTTGTGTTCGGGACAGTGAGGGTTCAA
ACTTCGGCGTGTGTGTGTGAACGAAAACcaaatacttcaagtatgAAAGACGAGGAGAGTGAGACAGCAATGTGGGCGTCTGTCTAATTCGTAATTGTGC
TACCAATGAATTGTACCAATAGAGACGCACGTGAGCCCAAATAGTGCGGGTGTCCACATTGAACTTTTAGCCGTCCTGTCAAGGTGGAACCTTACTAAAG
TATTTGACCGTACGTGGTGCCGCAATATCGGAGTAAAACTGCCATGAGTAGGTAATGGTAATGTATACACGTTCGTAGATCATGCAGAGTTTGTTCTAGT
AGTTGCCGGGTACGTTACAACGAAAGCGAATTGGTAACCTGAGGTGTCGCGGAGCCACTTCAAACTTGGTCAAACGTCTGCGAGAACGTCAACTGGTGTG
GCTCGTTACTTTCGCGACTCCTACTGGTCACGCTCTTGTGTTGAGCGCGCTGAAGTGATCAAGGTGGTTGATAAAGGCGCAGTCGATCTTCAGTGACGGC
CGCGTATTCGGCCGCCAGACCTGGTCCAGTTATTGTAGTACATGCATGATCACTTGCTGAAGCAccgctcgtgctgctgtgaagcagcaagacaTGTACA
GGTCATTCGAAAGCTTTGGCCATTATCACTCAAAACAATCAACAACGCGAAAATTTGACGTTGCAGCGTGGATCAAGGATCGGCGTGGTGTATGCGACCC
GAGCaataaatacatgtagtgattGATCGAACAACACCTCGATAATTGGAGCTGCAACTTCTAACCATTTCCATTCCAGCAACAATCCAGCAACATTTGG
TGCATGTTACCGGTAGGTATTTGATAGTC