Description :
From Genome Similarity Track
Location :
scaffold_43:25684- 27877
Transcript NameFunction/comments
Plaha_PHALS_03313hypothetical protein

Sequence
2193 bases(100 bases per row)
AAAAGTATAGTGTATCAAGATATAAAAACCACGAAGGGCAAAATTTTAGCCTTTATAGGCTGCGCGGATGGCGGAGACCTGCTCTATATGCCATATCTAG
AAAGCATATCCGCCGTAACGGTTTTTTCTGCGAAGCGGCCGGAGAACTCCACAAGCAGGACTGGCGAAGTCACCAAACGTTCTTGGACTAGCGCTTATCG
GGTAGAATTTATTGAAATTATATTGTTATACGAAGTCCGCCAGCTTAATTTGACGTTGGCACAGAAACTGATAATCTCGTGGTGCACCAGTCAATCATTA
TCCTTGAAGGGTGTTAGACAGAGAAGGCTGAAAATTGCATTGGGATGTTGAGGAAAACAGCTACGTGAGGTAACTCGATCTACCTGGCGAATTTTTGAAT
ACATCCATGAGAGCTTCGGAGTTTTACAAAGCTGTAACGCTGGATACCTCAGGACAGCATCTGTTCATCAGAATGTACACCAGCAAACTCCTTGGCGTCA
TGAAGACAACTTCATTTCGTCTTCAACTCGATCTAATGATGTCGCTGTCAAGGGCAGCAATAGACTGCTGCAATCGTTTCTTTTCCGCGCGAAAGAAGGC
GATATCTCGCAgcacatcttcgtccagcaCAGAACAAATCAAACCAGTCTTTGCTGCCAATGTTGTCGATGCAACTCCTGTCCAAGCGAGCTGCTTCGCG
AGTTTTGCAATTGTCTCCACGACGCCTCGTAGCTCCGCGATAAGCTTAAGGCGTCTATCATCCTCCAGTTTCTTTGTACGTATACGAATAAACTCATTCG
CTATATCGCGGTCACACTCAAGGCGCGAGATCTGAGAATATTCACCATTATCGTCAaaagaaacgacaacactgCTGGACCCATGCGATGCCACATTTAA
GGGAGATGCTGGTGTTCTCACTTGCGTCGATATATTATTGGCAGCAACCTGCCACTTTGAATGGGGCAAAGTTGGCCTCTCCAAATTATTAGTCTGGTAG
GGCTCAGTTGTTACCTGCATTATTGCTTTATGTTCTTTGTTATTATGGAAGTCGAAGGTGTCCGAATTGTCGCTCGACGTTAAAAAGCTGTCTTCTATCT
CATCCGTGGCATTAGTGCCACTAACTCGACGCCgcttgtgcaaggtgcccaCCTTATGATCTCCATCCTGCCCAAGCAACACCTCCAAAAATCGACGATT
TGATCGCAAAATTTCGTAGCAGTGACGAAAGTGGAAAGATTCAAATTTGAGTTTGGGATGAACCACATATGCCTCCAAGTCGCTTGGAGTAATTATTGGT
TGCTGACGGTCCCGTACAAACCGACGCATAATAGTCGCATTAATTTCACTACGCTCTTCTTTAAAAAGCTTTTCAGCCTGCTCTATAGCCTTGAGGGGCT
TCTTGCCAGCCTTTTGTAGCTGTTCAAAAGAAGTGCGTCAGCAGTGTTTACTTTACACTGACCGCAATCTTAATGCACACACCTTGTCTACAAGCGACGC
AAACAAAATCATGTCAGGTCGAATGCCGCGCGCCCATCGAGTGTGAAGCGACCGAGCGCTGCGTAACGCAACTGTTATGTCTGGCACAGCTGCCGGCTCC
GCCAATACGAGTTCGTGGTAACGTTTATGCACGCGCTTCCAAAGCGCGCAATTATCACTCAGCATCACTTCCCTGTGGCTGGCGAACACAGCGAGTAACG
CCTGGCTTAAGCGCTCGTCATCCAAGTGCGTCCAACGTTCCTTACCTCTTCGCATCCTCAAATTATTGGTAAATGGCTTGTGCAGGCATCTAAAATAGAG
AACATTTGAATTCTACGAAAAGCTAAGCTGTACTCTATGGCCCGCTCTATACGAAAATCTACCTTCACTTCGTAATTTATTTATAGCAATAGATTGATGC
AAAAGTTTATGGTCTGAACTAGACGATTTGCCTAAATCACTCGTCGATTCACCAACTTCAGCCGACAAGTCTTCGACCAGCTAAAATAATAGTCGTCATG
GTAAGTATTAGAAAATGTCTTATATATGTTACTACGCAAGTTCTGATGAGGAAAGGTCTGATAGAAAATGTTGACACATGTGATCAGGATGCACCCATTA
TCGGAATTCAATTGTGGTGTCTAATCTTCCAACCTGAAAATGATGCTATGAAATTTGTGATGACGCAAAACTTTAAGCCTGCAGAATGTAGTG