Description :
From Genome Similarity Track
Location :
Scaffold_8:256834- 258379
Transcript NameFunction/comments
Physo_305981Hypothetical protein

Sequence
1545 bases(100 bases per row)
CGCTCAAGTGCCCCGTGGACGCACGCGTTCAACGACCAGATGAACACGCTGGCCCACTACCAGTTCCGGCGGAGACTGCTGGCGAAGTGCGAGGTGGCGG
GCGAGGCCATGGTGCTGTGCTCTGAGATGTACTCGAGCCGCACCTGTGGCCGCTGCTGCCGCCTCCACCTCACACTGCGCAACGAAGATGTATTCCGGTG
CCCCCATTGCGGCTTCCTGGCTGGACGAGACGAGAACGCGGCCTATAACATTCTGCGGTTCGTGTGCGCGGGCTCTCTCTCGGTTTACGCAGTGAATGGT
GTCAGTGCAGTTGTAGTTGGTAGTGTAGTTCTCGGGTTGCAGCGAGCATGGCCCCGCCGATGAGAAGCGCTAGGCTTGACGGGGTGAGTCACCCCCGGGT
GGCGTACTGTAACACGAAGTTTCATGCGGATTGTGCCGTCTCGTAGACCTGAAAAAGTTGTTGAACTCCTCTGCACGCGACACGATGCGTATCCCAGTGA
CTTCAGGTGTTCGCAGCTTCATCTTAGCTGATCGCGGGCGGTGGCTGAAGCAACTCAAGCGCAAGTTCTCCTTGCAATGGAGAAAAACGAGGTTGTGATT
ACGTGTCCTCGCCGAATCTACGGGCGCGTCGAGCTCCACGTGAAGAAGCTGCTGCGCAACATTGAGCCGGAATCCGTCACGCTGCAGCTACCGGAGCACG
TCAATATGGGCAAAATCATCGGAAAAGGAGGTCGAATGGCGAAGCAACTCGAAGCCAACGTGCAGGAGCTGCTCTCCAGTGAGCGCTGTGGTGCCGGCCA
CTTGCACGTCGGCAGGGGCCAGGTCATCAAGATCAACAGCCAGTCGCGCGAGATCGTTGTGACGCTGGAAGGAGCGTCTAGGGCCTTGATGTCGGTCATT
GTCGGGCGGTTCAGTCTCTGATTGTGGAGACGCATGGACACAATACGCTGCCTCTAGTCACGCCCGGGCAGCAGTTGCAGCAGTGCCCTCGACTCGCGCA
GCTGATGAATAAGGTGCCGCCGACAAGCTGGGCGACTCGAGATGATGTCGTGCTTCAACTTGCTCACGCGCTAGTGTGGCGCTGCAACGCCAGCATCTGC
GGCGGGTTCCTTCGGGACTGGGTTGTTCGTGGTGAGAGCGCCAACGATATCGACGTACGTCTGTCGCCGCCTCAAGTTACAGCCTCCTCTGTCGAGAGAG
CACTCCGACAGTTCATCTGGGGGTCGATTGGCGCTGCTCAGTGCCAGGTTACAATCATCAGTCGGGCGCAAAAAGGATCGGCGTTCGCGCTGACGTTCCG
CGCTGCCAACATAGAGGCTTTCGATGTCGACCTCGTTGATCCGTCTGCAATCTTGAAGAAGATGCACCCTGGCGTCGACTGCGACGCCGGGAATCTGCTG
CTGAACCGGAAGCAAGCCTTGTGCAAGAAGGTCGAGGGGGCTGGGGACTCGTGGTGCGCTGCGCTGGAGAACGTCCTCAAGAAGCAGTTTGTCTTCTACT
ACGCGTTGGATACACGTGATGCAGACCACAACACTGAAGCCCTCC