Description :
From Genome Similarity Track
Location :
Scaffold_4:256813- 259673
Sequence
2860 bases(100 bases per row)
GGTAAGGCTTTAATCGTCCTACGTAGAACGTAGGGTGTAGTCGCATGCGTTTAGGAATGTCTAGTGTGTATGCATCCCCATTGCATTTAACTACCCTGAA
TGGCCCAATATATCTTGGCAGAAGTTTCGAACTCCCCAAGTTAGACACTGCATGTTCAGGCAGATTAGCCGTACTAAGTAATACAAGATCATTAATCTTA
TATACTTGCTTGTTCTTCCTTCCACTCTTGTCTGCTTGTTCTTTTTGCAGATCCTGAGCTTTTGCAATTGCGTCTCGAACAAACCTTACAATGGCTTGTC
TCCTCACAATAAAGTCATCGACTTGCTGTGCCTCACGACTTGTCATGTCGTTTAGAGGTTTCATCGAGTCAAAATTCGCTTTTAACTCTGTGACAGCATT
CAGGTCCGACTGTGGCTCCTTAGCCGCAGTCTCTCCCCCACTTAAGGTAGAAACCTCTCCCACTAGTGACGCTGGCACTCTCGGGTGGAGTCCGTAGTTC
ACATAGAACGGGGTATGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTCCACTCTCCGAAAGACGTCGCAT
AGCTGCGCAACACGTCTTCCAGGACACGATTCACTCGTTCAGTTTGACCGTCTGTCTCTGGGTGTGCTGCTGTTGACATGGATAGTTTCGTATCCAAAAT
GCCAAACAGAGTACGCCAGAATCTGGACGTAAACCGAGTGTCTCGGTCGGACACGATCTCCCAAGGCAGACCATGTAGACGGAACACCACGTCTACAAAG
ACTTTCGCAGTCATCTCTGCCGAGATCTTGTCAGAGACCGGAGTAAGATGCACCATCTTACTAAATCGGTCCACAAACACCAGGATGCCATTCCTGCCCG
TGTTTGCCCCTTGGAAGTCCGAATATGAAATCCATACTCACGGACTTCCAGCTGTCGGTTGGCACTGCCAATGAACGAAGTGGGGCTTGTGTGGAGCCAG
AGGGCTTCACACGCTGGCAGATTTCGCAAGTCCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGGGAAAGATTGAGAAACGT
TTTCTCACGTCCGAGATGACCACCTGAGGGACTGTCATGATACTCATACAAGAGTCGATGACGCAGGCCCTCGTCGTTGGGAACAACAACCCTTGCTGTA
TCCCCATCTTCAACCGCATAGTACAACAACCCATTGTGTACTTGGAAGCGGTGAACACGCGATCTTGTTCGAGCAGGCAAGCTCTGCAGTGCTTTGTCCG
AAGGATCTTTGAAGTACTTCAACAAGTCCTGACATGTGTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTCGTGGCTTGAACTGCGAT
CGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTGTCACTCTTGGACTTCGGATCGTAATCCGGACGTCTTGACAATGCGTCGGCTAAGATG
TTCGTCTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCTGCAAAGAAGGAAAGCCATCTCGCCATTCTTTGCGACAAGTGAGGAGTCTTTACCGCTG
TCCGCAGTGATGCGTGATCAGTGTAAATAGCAAAGCGCTCCTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTCATCGCCAGAAGTTCCTT
GTCATGAACTGGGTAGTTCCGTTCTGCGGGTCGGAGTTGTCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTGTTGCATCAATGCACAA
CCGATGGCATAGTCGCTCGCATCACAGACGACATGGAACGGCTTGTCGTGGTCCGGTAAAGCCAACACAGGAGCTTCACGAAGACTCCTCTTGACTTCTT
CGAACGCCGTTTGATGGTCTTTCGACCACTTCCACTCAACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACTAACGCTGCATAATTGCGCGTGTACTT
GTGCAAGTAATTGGCCAGACCCAACCATTGTCTCAGCTGTTTGACGTTCTTTGGCTCAGGCCAATCGTCAATAGCTTTGACCTTCTCCGGATCAACTCGA
ACACCGTTCTTGCCCACAAAACAACCGAGAACAGGGATCTCGGGAGCGAAGAACATACACTTCTTCAAGTTTGCGTACAGTTTGTTTTCACGCATGACCT
GGAAAACTTGACGAAGATGATCAAGATGAACATCAACATCAGATCTCCCATTCGTGGCCTTACTATGAACGAAGATATCGTCAAAGTAACTCGGTGCAAA
TGTTCGTAAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCAGGAGCATTCTTCAGTCCCTGTGGCATCACTAACCATTCCCACAGCATACCA
CTAGGGGTACTCACTGCAGTTAGTGGGACATCATCTTCGCGCATTCGAATCTGATAGAATCCATCTTTCAGATCGATAGCACTAAAGATGGTGCTGCCAA
CCATTCCATCAAGGATCATGTCCTTGCGTGGAACCGGAGTTTGAGCAGGTATGGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAACAATGCGCCATCCGCC
AGTTGCTTTCTTCACACAGAAAGTGGGGCTGCAATGCGGAGACTTACTCTCTCGCACATGGCCAGCCTTTGCACGTTGCGCAAAGAACTCATCAATCGCA
TCGACTTGTTCCTTTGGCAACGGCCACTGTCTTGTGATGCAGTACTTCGTGCCAGGAAGTACGTCAATCTCATGACGAATGCCTCTATCAAATGGCAATT
CGTCCGGCACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGT