Description :
From Genome Similarity Track
Location :
scaffold_224:25681- 30549
Transcript NameFunction/comments
g5915.t1hypothetical protein
g5916.t1 stomatin-like protein

Sequence
4868 bases(100 bases per row)
AATGACAGCGTCTACGTGGGTATCATCAAAGCTACAAAGAACCGATGAAACAGTAAAACGATACACAGGTGGTGGAAAGCGTTAGATGATAGTCTCCAGC
CTATCGAGTTCCAGGAAGTTATATGACTTCAGGCGATTTGAGAGGTACAACACGATCCAGTGTAGGAGAAAAGGGTGGCATACATTGATCGGGAGGTCTC
ACTGGTGACCTGATGTTTCTCTTGTTTTTCTTCCTGCTTCTGACATTTTTCGTTGCCTCGACTGCATCATTCAGGCAAAGCTTCACTTCCTCCGAAATAT
TTGTGTTGCACTTGGATTATCACACCTCACTTCACATTTTTGGTGGCAACTTGGCATTTTTTACTTGCGAAGGTGGCCGCTCATCAGATTAATCTGGCAT
TTTATGGTCGTGTGAGTTTAGGAGAAAGGCGTATACATGTACATGTACTGCAAATCCACAACGTACCCAATCCAGTTCCTCGTTCGCGGCATTTTGGACC
TTTTGCGAGAGGTCAGAGATTTCGTCTTGGTGCATCTGCAGCTCGTTCTCGAGGGACGCGATGGGGCGTTGCTGGTATTGTTTCATTTGCGTCTCGAGGT
CTTGTAAACGTGTCAACTCGGCCTGCAGTGTAGAATCTTGGATTTCTGCTGACGAGATTCCTCCTGAACACAAAAAATCGTGAATAGTGCAAAATCCACA
GCAATTTCAATGCTTTCCACCTTTTTGCGCTTCCGATAGCGACGTGACGCCGTCTGCACCCGCAGTTTACGCCGCAGTTCGTCAAACTCGGCTGAGTTCA
TCACTTTTACTCTTTGGCCAGTCGGCAAAACGTTGGAGGTTGCAGATGGCGGAGGCGGTCTTGGCTTCTTAGGAGGTGACGCTCTTAAGCTTCTGTGGCG
TCACCAGGCATTTGGGGACCAATAGAAGCTTCAGGCGGGATTGGAATTGCCACTGAAGTAACGACTTAAACTGGCATCGGAATTTCCGCAAACGCAGGAA
AGAGATTTACTGGATTTACTGCGACGAGTGATACCTGAGCAACAAAACAAGACGAGGCAATGAGCAATTCTGAGGTCGTTTCAGGGGGCAACAAGTAAAC
CTACGTCGAAGGTGGAGCCCAGGGACTCTGGAGACCAGGAGGTGAAGCTCTTTGAGCTATTGGCATGACGGAATCCGACCTATCGTATCCACGAGAATAG
CACAAACAACAACAATGATGCCAGAACAAGTTAGACGAGGAGCTACTAGTAATCTCTAATGCAGCTTGCTCAAGGTAAAACATGGCGGTTAGTTCACGCG
ACACAATAGTTTAGAGGCAAGGGGCTGCATACATTGAGTTCTGCTGTAGTGCTTCATCTGCTTTCACTTCTCCCTGAAACTGCACTTTTCTGTAGTCTGC
AGGGTATTTCTCTTCCAAACTATCGCCCTTCCTTGGGTCTGCAGCCCCTTGACCTCCACTTGGCACCGACACCCCAACATCGTCTCCACTGTCCCCATGG
TTGTTTCCGCTGCTGTAGTCATGGTTGAACTCCGACACCATGGACGTGTGGTTGCTCCCACTGGCGCTGCTCACAGTCGCCGACTCCACGCTGGTCTGGA
CGGGGCTGTCGGCAGCCAGCAGCTCCTCCATCATCACGCGGTCGCCCATGTTAGGCCCGAAAAGGTGAACTGGACGTCGCCAAGACATGAAAACAAAAGC
TTCACGAGAACGATTGATGGGAAGTGAAGAGAGCGAACGGAAAAGGATTTACGCTGGCTTCGTGCTTCGAGCGGTGGAATCTGGGACGGGACTTGAGAAC
GAGCGTTCAACGGGTGAGAAAAGGCTCCAACGCTACGGATCTCACTTCCGATTCCGCTCTCGTCATCAGGGCTCCATGCCAGCAAGCTAAAGCTGAAATC
TTCAATTACTGGCCTCGTTTTATATTGCACTCAGCCAAGATGCGAACTCGGTGCAGCCGAATGCCAACTCCCAGCTCTTCAAGATCTCGGTCAGTCGCTT
GGATAAGCAAGGCGCCGTCAATTCCCTGAGCACGGAAGTTAGCTCCATAACTGCCGTCGTCTAGCCCCAGCGAGTCCATAAAGTTCTGCACTTCTCGAAC
TCCCCATCGCTCCATGTCTTCATGAGTTTCAAGTTGTTCGTCGGACGATTTCTGCTGTTGTCGATTTGGGGTACACAGCCCCGCAGTGCGTTTGTGCTCC
TCCACTCTTACTTTGGACAGCGACGCATTCACTCGCAGCACCAGATCGTTGCGGATCTGTTCGTCCTCCAGCAACGCTTTCTCGAAGAGGGAGGAGTATG
TTCCCCCTTTGTCTTTGCGGCGTGCCACCTCCGAAGCAATTAATGGCTGTGAATGAGATCGTGTAGGACCTCGAGAGCCTCCACTTGATCCACGACGGTC
CTTTGTCGCGCGATAAATCGCCTCTTTGCGTTTGAGTTCGTTCTTGCGCTGATACAAGTCTCCTGAACGGAACTTGAGGTCATTCACCAGACATCCGATC
CGTGTCTGCAATCGACGGCGTTTGTCTGGGAGAATAATGTCTTCGAGACGGGCCTGAAGAGCAGCAAGCTCGTTTCGCATCGCACCTAGCTCATGCTCTA
TTTGAGTTATCAGCTCGCGACTCAGCGCAATGTCTTCACGCATGGAGGCTTCTCGGGAGTTAGTTGCAGCTGGAACAGTGGCAGGAAGGGCTCCATTCTC
GCTTCCGTCGGCAGCTTTACCTTTATCGGTAGTTGGTGGACTTCTGTATTGCGATTGTGACGATTCCAGCGGGGCCACGACAGCAACGGGATCGCTTACA
GACTCACCCATTGAATTAACCGGGGCATTTTCGGGTGCTTGCCTCATTCGAATCTGTCGATGTCGAACTTCTGCATCCCGTTCACGCAGTAACATCTTCG
AGGCGGGGAAGACTCGACGCATACTGACATCGCCGACCCAGTTGCCAAACAGGCGAACTGCAGACTCTTGATCTTCCTCGCGAAGTGCTGGGTGGTCTAG
GTGAATCTGAGCAAGGAACGGGTTCTGCGTCAGCCGTAACACTTGTAGTGACTCGAGGAGATCCACGCCTCTGAAGGATTGTAAGAAGTCCAAGTCGGAC
GTCATCTTGAGCAAGTAGTTCACCCCACGCCATTTGAAGTTTGTAACCTGCGCTTTAGCTTTCTGCTCTTGCTGCCACCGTCCGATGTCTTCGACAATCT
GCACGCTTACGGAGCGTATTTGATCGATGACGCTCTGGAAAACCATCGGCGCTTTGGATATCCCCGAGATTCGAGGCTGCTGTGGCCTTTTGGCTGCCCC
AAGGAGCTGCTGCAGTGCCTCAAGACAACCTTCACGCTCTACAATTTTTCTCACAATATCCAGATCGTAAGGCTGTTCAAACGAAGCGCATGGCGGAAAC
ACGAGAACAGGAGAAGCACTGCTACGGAATACGCTCGCCGCGGTGGTCATCGGGTGCAGCTTTGTTCACACGTGGACGGAGACAAACTGGTGGGGTAGCT
TATATCAAGCTCGCAAATGGATGAACACAAATAGTTCCACATCACTGATATCCATCGACTTGAATTGTTCCCCAAAATATCTGTTTGGGACAATAACGTA
CCACACAGCTTTCATGGCTTTTGCTATATTTTTCTTCAACTGTTTCAGACAGAAACACTTAGCTCGCGAGGTTAGCTGAAGCCCAGCAGTCCATACAACC
TGTCTGCCATGCGATAGCAACCATCTCACCTGTCATATTCTGCCTGTTTGTCCACACCAGAACCTCATTTCTTGTAAAATGCGCCTAGTTCTTGGTCGTG
TCTGGGTCGAAGCTGTCCAAAGTGTACTCGCCAAGCTCGCCTTCCGCACTACTCTGACTGCCCACCTTGCCAGCAGTGCGAGCCGCCTCCTTGGAGTTCT
GCTTTTGGATATTCCCGAAAATGGAGAGCGCGGACGCTACCATACTTGAAGGGTCATTGGTGTTAGCCGGCAACAGCACCGTCGTGCCCTCCTTAGCGAT
ATTGCCGAAGGCGTCCACATACTTCTCCGCTACCTGAAGTGCCACGGCGTCACGGCCACCCGTCTCCTGAATAGCCCCCGAAAGCCGCTGAATAGCCTCA
GCAGACGCATTGGCTTTGGCCAGAATGGCAGCAGCGGCACCTTCTGCTTCCAACACAGCAGCGCGCTTCTTACCTTCGGCCACATTAATGTACGCTTGAC
GTTCACCTTCAGAGTCCAAGATCTCAGCACGCTTCCGACGTTCGGCCTCAGCCTGCATGTCCATGGCCGCTTTGACGCTGCGGGGCGGGGCGATATCCCG
GATCTCGTACCGGAGGCACTTGATACCCCAGGCCTCCGAAGCCTGGTTAATAGCCTCCACGATGCTGAGGTTGAGCGACTCGCGCTCCTCGAAGGTCTTG
TCCAGCGTGATTTTACCCAGTTCGGAACGCATGGTAGTCTGTGCCAGCTGCGTCACGGCGTACAGTGGGTCTTCAACGCCGTAACTGGCATTGTACGGCT
CGATGATCTTCACATACAGCACACCGTCGATGTTGATGGTCACGTTATCCTTTGTAATAGCCGTTTGGCCCGGGATCTTAATGGCTTCTTCCTTCAGCGA
GTGCACGTAGGCGATGCGGTCCACCAACGGGATCAGGAAGTGCAGGCCGGGCGTCAACACTTCGTGAAATTTACCAAAGCGCTCCACGACCCACGCACGC
TGCTGCGGCACGATCAGGACGCCCTGCGATATTCATCATAATACATATAAGTCAAGTAAGTAAACAATAAGATATCAAATATTTATCTTACAATGTTGAC
AGGGGTGTCCTGCAGGCGGGGCACGCCGTCATCGAAAGGCTGAGCCAGAAGCGGTCGGGAGTTGTGCA