Description :
From Genome Similarity Track
Location :
Scaffold_1495:2568- 3785
Sequence
1217 bases(100 bases per row)
CGAACTGGAGCAATGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGA
GACTCATCGACTTCCAGCAGCCCGCTGGGACCAGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCGCTGGTACGTCTCGCACGTACG
GACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTGCGTCTTCTCACGGCCGAGATGGCCACTGGATGGAGCG
TCGAGCGCCTCCATCAGGATGTCGTACTTGAGATCCTAGTCGTTGGGCACGACAATACGGGTAGGATCCTCGGGCTCGACCCTATAGTGGAGCAAACCGT
CAACCCACTCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTCGGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAG
ACTGGCATCGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTCGGGTCGGCGCGACAGCGCG
TCGGCAAGCACGTTCAACTTGCCCGGCTTGTACTCGACACGGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCGCCATCCGCTGTGAGAGATGCGGTG
TGTTGACGGCAGTCCGCAAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCCCAGGAGGTGCACTCGGAACTTGACAAGAGCGTACTTCATGGC
AAGTAGCTCCTTGTCGTGGACTGGACAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGCCTTCATCGTCGGCCTGC
AATAGCGCACAGCCAATTGCGTAGTTAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGGCGCGCGCTGTAAGCTCG
CTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAGGGCCGTGCCAGCTCGGCGTAGCC
TGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGCCAAGCCGCGATGGTTTTCACCTTCTCC
GGGTCCGCCCGGACCCC