Description :
From Genome Similarity Track
Location :
Scaffold_4:256799- 262046
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002079Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
5247 bases(100 bases per row)
TGACCCACTTGGAAGGTAAGGCTTTAATCGTCCTACGTAGAACGTAGGGTGTAGTCGCATGCGTTTAGGAATGTCTAGTGTGTATGCATCCCCATTGCAT
TTAACTACCCTGAATGGCCCAATATATCTTGGCAGAAGTTTCGAACTCCCCAAGTTAGACACTGCATGTTCAGGCAGATTAGCCGTACTAAGTAATACAA
GATCATTAATCTTATATACTTGCTTGTTCTTCCTTCCACTCTTGTCTGCTTGTTCTTTTTGCAGATCCTGAGCTTTTGCAATTGCGTCTCGAACAAACCT
TACAATGGCTTGTCTCCTCACAATAAAGTCATCGACTTGCTGTGCCTCACGACTTGTCATGTCGTTTAGAGGTTTCATCGAGTCAAAATTCGCTTTTAAC
TCTGTGACAGCATTCAGGTCCGACTGTGGCTCCTTAGCCGCAGTCTCTCCCCCACTTAAGGTAGAAACCTCTCCCACTAGTGACGCTGGCACTCTCGGGT
GGAGTCCGTAGTTCACATAGAACGGGGTATGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTCCACTCTCC
GAAAGACGTCGCATAGCTGCGCAACACGTCTTCCAGGACACGATTCACTCGTTCAGTTTGACCGTCTGTCTCTGGGTGTGCTGCTGTTGACATGGATAGT
TTCGTATCCAAAATGCCAAACAGAGTACGCCAGAATCTGGACGTAAACCGAGTGTCTCGGTCGGACACGATCTCCCAAGGCAGACCATGTAGACGGAACA
CCACGTCTACAAAGACTTTCGCAGTCATCTCTGCCGAGATCTTGTCAGAGACCGGAGTAAGATGCACCATCTTACTAAATCGGTCCACAAACACCAGGAT
GCCATTCCTGCCCGTGTTTGCCCCTTGGAAGTCCGAATATGAAATCCATACTCACGGACTTCCAGCTGTCGGTTGGCACTGCCAATGAACGAAGTGGGGC
TTGTGTGGAGCCAGAGGGCTTCACACGCTGGCAGATTTCGCAAGTCCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGGGAA
AGATTGAGAAACGTTTTCTCACGTCCGAGATGACCACCTGAGGGACTGTCATGATACTCATACAAGAGTCGATGACGCAGGCCCTCGTCGTTGGGAACAA
CAACCCTTGCTGTATCCCCATCTTCAACCGCATAGTACAACAACCCATTGTGTACTTGGAAGCGGTGAACACGCGATCTTGTTCGAGCAGGCAAGCTCTG
CAGTGCTTTGTCCGAAGGATCTTTGAAGTACTTCAACAAGTCCTGACATGTGTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGTCGTCGTG
GCTTGAACTGCGATCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTGTCACTCTTGGACTTCGGATCGTAATCCGGACGTCTTGACAATG
CGTCGGCTAAGATGTTCGTCTTGCCTGGCTTGTAGTGTACAACAAAGTTGTACTCTGCAAAGAAGGAAAGCCATCTCGCCATTCTTTGCGACAAGTGAGG
AGTCTTTACCGCTGTCCGCAGTGATGCGTGATCAGTGTAAATAGCAAAGCGCTCCTCGCCAAGCAGATAGACACGGAACTTGACAAGAGCATACTTCATC
GCCAGAAGTTCCTTGTCATGAACTGGGTAGTTCCGTTCTGCGGGTCGGAGTTGTCGTGACTGATACGAAACAACTCGCTCTCGACCCTCATCATCGTGTT
GCATCAATGCACAACCGATGGCATAGTCGCTCGCATCACAGACGACATGGAACGGCTTGTCGTGGTCCGGTAAAGCCAACACAGGAGCTTCACGAAGACT
CCTCTTGACTTCTTCGAACGCCGTTTGATGGTCTTTCGACCACTTCCACTCAACGTCTTTCTTCAAGAGCTGTGTGAGGGGTTGCACTAACGCTGCATAA
TTGCGCGTGTACTTGTGCAAGTAATTGGCCAGACCCAACCATTGTCTCAGCTGTTTGACGTTCTTTGGCTCAGGCCAATCGTCAATAGCTTTGACCTTCT
CCGGATCAACTCGAACACCGTTCTTGCCCACAAAACAACCGAGAACAGGGATCTCGGGAGCGAAGAACATACACTTCTTCAAGTTTGCGTACAGTTTGTT
TTCACGCATGACCTGGAAAACTTGACGAAGATGATCAAGATGAACATCAACATCAGATCTCCCATTCGTGGCCTTACTATGAACGAAGATATCGTCAAAG
TAACTCGGTGCAAATGTTCGTAAAGGACGAAGAACGTTCGTGACCATTCGATTGAAGGTCGCAGGAGCATTCTTCAGTCCCTGTGGCATCACTAACCATT
CCCACAGCATACCACTAGGGGTACTCACTGCAGTTAGTGGGACATCATCTTCGCGCATTCGAATCTGATAGAATCCATCTTTCAGATCGATAGCACTAAA
GATGGTGCTGCCAACCATTCCATCAAGGATCATGTCCTTGCGTGGAACCGGAGTTTGAGCAGGTATGGTCGCGTCGTTCAGCTTGTTGAAAGCGTGAACA
ATGCGCCATCCGCCAGTTGCTTTCTTCACACAGAAAGTGGGGCTGCAATGCGGAGACTTACTCTCTCGCACATGGCCAGCCTTTGCACGTTGCGCAAAGA
ACTCATCAATCGCATCGACTTGTTCCTTTGGCAACGGCCACTGTCTTGTGATGCAGTACTTCGTGCCAGGAAGTACGTCAATCTCATGACGAATGCCTCT
ATCAAATGGCAATTCGTCCGGCACCTTGTCTGGGAAAATGTCTTCAAATTCCCTGGCAAGTGCATACACGGGGTTGGTTTTGAGAGCGTCCCATGACTGC
TCCTCGAACCTTTCCTTCCGTGTCTTCTCATCAAGCACTTCAGCTTCCATTGCTGATACTGTGCTGATGTCCTCTGCATCGCCAACATCGACGATCATGC
AGATCTGCGAGATTTCGCCTCTCGCTAGGCTACGCTTCAGCGTCTTCTTGCTCATCGATGGCAAGGAAATCAATTCTTGGACAGAACTTGGAGGATTTTC
CACTTGTACGTGACGGATTACATTCACGTCACCTTCTTCCTTGCAGACCGCGATATTCACAAATTCGCTCGAAGTGACTCTTGCTTGGACACTTCCTTCG
TCATCTTGACTTGTACCTTGATCAGGGGCACTTGAAACTCTTGATGAAACACTCTTCTTGCTGGTCTTCTTTTTCTTGTCTTGGGGCGGGTCTCTGCCTA
TCTTCCCGTCATTCTTCATACTACCATCGCACGCAACTTTGTCGTCGATGGCAAAGGAGACAGTCTTTTTCTGGCGCCTGACTGCTCCACCTCCGTTTGT
CTTCTTCAAAATGGGTGCCACTTGTGAACATGGGGGGCATCGCACACCGCAATATCACAAGGGCCATCTGAGATTTCTTCCACAGATGTATAAACCCATA
CCACTTCATCCGTTGTCATGCTGCTCAAGTCAGCGCTGCATGACTTGTCAACGGAGATCTTCATGTTCATCCAGTCAATGCTAGGTTGGTAACGCTTCAA
CCATGGCATGCCCAGGATGATGTCAAACTTGTCATCGAGGTCGAGAAGGATGAACTCGTCCTCGCCTCGGAAATCTTCACACTTCATTGCCAAGCGAACG
ACTCGCTTTGGCATCTTCACAGTTGACCCGTTGGCCAACCGAACAATCATCGTCTTCTCTTCATTTGCAACAGGCACAGAGATGTTGTGCCTGGCAATCA
CTTCATTTCGAACAAAGTTGTTCGACGCACCAGTGTCAACCAAAGCTCGTAGAGGCGTTGCAATACCGTCTACATGAACTTTGAGAACGATCAAACTTGA
CGTTTGACTGACACTCTTCTCACTCGTGGAAACTGCATGTGCATCATGCACATTGGGGCCAGAGTCCTGTGTTTCCACAACATTCACAGTCCTCTTCTCG
AGCCCAGTAGGAGGCCCCGCCCCTACTGGTCGTTCCCGTTTTTTGACCTTTGGGAACGATCGAACCGACGACCATTATTACGGTCGTAGTTGTTCGAGCG
CGAGCCCTGTGCCGTTTGCCGATCAGACAAAGACACTTTGCAGTTCCGAGCGAAGTGACCCGGCTTCCCACAACGGAAACACTTTCCATCGTTGCGAGGA
CGTTCATTTCCAGGCGTGGAAATGTACGAGATGTCCATCGGCTCTGGGCCATCATGAACAACGTTTGGTTGCCTTGGTGGTCTTGCCGGAAAACTTTGGA
ATTTGGCTTGCTTGATGCTGAATTCTTCTTGCATCGCACGGCTGATGGCTCCTTCCAGGGTCTTCGGGTACTCACGGAACAGCTGGTTCCGAATCGGACC
ATCGTTCAGACCTGTCATGAACGTCACGACTTGCGTTGGGATGTCAATCGGCTCGTCCACGATGCTCGATACCAAGTAGCGAGCTCGTTGTGCGTACGAG
TGTAGGTCGTATTTACCCTGACGAAGCTTTAAAAACTCTGCGCGAGCCCGAAATTCGCTCTGCGGAGGTTCAAAAGCCTTCTTCAGCTCTCGCTTGAAGT
CGTCCAGGTCGTAGAAGCAATGTGGCTCCGCCAATCGCTTCCATACGCCAACTTTTCGCTCGACCCGCAAGTTTGACATGCAAAAAACTTGCTGTTTGGG
TCCCGTAGTTGTCTTGCAGTGATCGCTGCATCCAACTCAACGAACCATCTCGCTAGAGGCTCGTTCTCTCCGCCACGGTACGGAGATACATCGAGCTTCA
GAGGTGCTACTCTCATCGTCGTGACAGGAGTTGCAGACTGTCGATGAGAGTTCATGATCTCGTGATGCATGAAGCTCGTAGCCGCGTTCCTCTGCTCAAC
CGGTGACGCTGATTTCAGCAAGCTGATCACAGCCGCCTCACCGATGACCGCTCGCATACGCTCGAGGGCTGCCCACTCGTGGCTCGACAAATGAGGAAAA
TGCTCATTCGTCAGCTCCACGGTTTCTCCAGGCATCGAGCCCATCGGCGTCTCAATCCCTTCCATTGTTTCTCACAATCGGACAGGGGTCTTGGAATGTC
TGCGCACGCTACACAAGCGGCCTATGCAGACTCTTGACGTGGTCGTTGAAAGGACTACGAAGTGCTACCAGGTGTAAGAGGCTATCCGAGACAGCCTCAA
ACACAGCACGCACGCTTGCGCTTGAGAGGAAGACTTGGGAGGAACTT