Description :
From Genome Similarity Track
Location :
Scaffold_59:25673- 27603
Transcript NameFunction/comments
Phyke_g2734hypothetical protein

Sequence
1930 bases(100 bases per row)
ATGACGATAACGGAATCAGGAGAGACTTCCACAGACTCGGAGCTGCCTCCTCACGTATTTTCCATCGGTGGGAAGGCCTTTGGGGGTCTTTTGAAGGCGG
AGAGACGTAACCAGAGCATTCTGGTTAGTGGAGAGagtggcagtggcaaaaCAGAGGCCACCAAGTTCCTGATGCAGTTTTTAACCAGTGTAGGCACAAA
TCAGAGTCAAACGACAGCACAGAGAGAGGGCAGTGGAGCAGTGGAAATTGGCAAAAGGATTTTGCAGACGAACCCAATTCTCGAATCTTTTGGCAACGCT
CAGACCATCCGAAACGACAATTCCAGTCGCTTTGGCAAGTTTATCAAAATCCAGTTTGGAGACAAGAACGAGATCGTCGGAGCGCAAATTGTCAGTTATT
TGTTGGAGAAAGTGAGACTTTTGCATCAAAATCCAGAGGAGCGCAATTTTCACATATTTTATGAGCTACTGGAGGGAGGAGATAAAGAACTGCTAGAGAT
TTTGGGACTGCAAAAAGGTGCAAAATATGAGCTGCTTAACTCCTACGGACCAAATTTTGGTCGGAAGGGAGGTGTGGCAGACAAATACGCTCAGCTGTAT
GTACAGACTGTACGGGCATTTGAGGACACGGGAGTGAACAAACAGGAACAATTGGAGATTTTCAAGATTTTGGCGGCGTTGCTACATTTAGGAAATGTCA
GTTTTGACGATGCAACTGGAAGACAGGAAGACACCACGGTTGTCACAGAAACATCGCGATTCCATTTGGACAAATGTGCGGAGCTTATGGGGGTGGCTGT
TACCAAATTAGAGGCGCTTCTGGTTAGCCGCGAAATTAAAGCTGGTATGGAAGTCATGGTGCTCAAACTCAATCCGGAGCAGGCCAAAGATATCTGTCGG
TCTCTGGCTAAAGCCGTCTACGGCCGCCTATTCACGTGGCTAGTGCGTCGCCTGAGTGACGAGATCAATTACTTCGACTCAGCGGTGTCTATCtctgatg
aagacgaggattTGGCCACAATCGGCATTTTAGATATCTTTGGCTTCGAGAGCTTGAACTGCAACGGCTTTGAGCAGTTGTGTATCAACTACGCGAACGA
ACGCCTCCAGGCTCAATTCAATGAGTTCGTCTTCGTGCGAGAACAACAGATTTACATTGCTGAGGGAATCGACTGGAGCAATATATCGCACCCGAGTAAC
GAAGCATGTCTGGCTCTCTTCGACGACAAGAGCAATGGTTTGTTTTCACTTTTGGACCAAGAGTGTTTGATGCCCAAGGGATCCAATCAGGCCTTGAGCA
CGAAATTCTATCGGTATCATGGTGATAGCAACTCTGCAGACTCCGCAGGGCTATTACAGCAGCCGCAGATTGCTCAAAGCAAGCTGCCTTTGCTCATGTC
GTCTTTCAGCAGATACCTGCACCGAACTGAGTCACAAGAGGAACCAGTTAACCAGGACAATAAGAAGCACCCATTCTCGGCGTCCAAGATGGAGCGCGTG
AACCATCACTTTGTGGTCCATCACTTTGCTGGACGTGTCTGCTACAATGTCGAGCAATTCGTGGAGAAGAACACGGACTCGCTCCCCACTGACGCAAGCG
TGATCTTGAGCTCTTCTAACAACAAAGTGGTGGCGGCGATCGGATCAGACGAGAACGTGGACTCACCAAGCAATGACAATGGGACGACTGGACGACGTCG
CCACTCCATGCTACGAGCGCCTAGCGTGTCAGCACAATTCAAGAGTCAGTTGGACCGCCTGATTGTTCAGATCGGACGAACAGAGGCGCATTACGTGCGC
TGTCTTAAGCCTAACGAGGTGAAAAAGCCAGGTATTTTCGATCGCGAGAGGATGGTGGAACAAATGCGCTCTGTCGGGGTGCTGGAGGCGGTTCGCATCG
CGCGTCATGGTTACTCTGTTCGTCTCACCC