Description :
From Genome Similarity Track
Location :
Scaffold_1634:2567- 4295
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1634-snap-gene-0.2Protein kinase

Sequence
1728 bases(100 bases per row)
GGACTTCCAGAACCAGTCCTTCCCGACGCTCAAGTCGCTGTACGTGCCTGCTGCTTATGATGAAATTGTTGTATCCATTTTCCCAATTTTTGACCTCTGA
CTAAACTCATGTGGCTATATGTTGCTAATAGCGACCTCTCTCGGAATGCGCTCACGGAGTTCAACTTGGTTTCAACCAACTTCCCTGCACTCACATCACT
GTACGTTTGTAAATCTGAATGCTACAACTTTGTCGCTGGACTGTGGTCTGGCCTCAACATTGTTATTAACGAATATTTTTTTATTATTACTGCTACTAGG
ATTCTCTCGAAGAACGCAATCAGTGAGTTCCCCAAGGTCGTGTTCAACTTCACGTCACTGGAGCTTCTCGCTCTGGACTCGAACGCGCTGAACTCGGCGA
AACTCACAATCGCGCAGTTGACGTTCCTGTCCAAGATCAGCCTCCTGGCGCTCGACGGCCCGACCGATACTGAGGCGTGTCCGAGTGACGACATCATCGC
GAAACTCAACACGTCGTTTAAATTCTGTGTGAACGCCAGCAAGGCCTCCAGCAGTGGTAGTAGCGGCAGCACCGCTGTCGGGTTCGTCCCAACATTGGTT
CCTGCACCACAGTCTACTGTCGCACCGGCCGCTCAAGCCAACTCGGGTGACAACAAGTCGTCGTCGTCATCCAAGACGTGGATCGTGGTGGGCGCGATCT
CCGGATGCCTCGTGCTCGCAGCCATCCTGTTTATCGTGGTCCGACGCAGACGGCGGCGTGATGAATCCCCCAAGCTCGCGAACAGCGCGACGCCGTCGAT
CGCGATCGGCATGGGCGACCTCGCTGACCACCCGTATATGGAGCTCAACGCGCCGTCGAGCTGCAGCCAGACGACGTCGGACTTTGAACTGCTCGCGAAT
GTCGCCGACGGCTACATTGCGCTCACACGGCTGTCGTACAACGACGTCTTCTTACACCGGATGATCCGTGTGAGCAGCCGGTCGGAGCTCTGGTTTGGCG
AATACATGGACGAGTCCGTGATCATCAAGAAGATCAAGAGCAACGCCGCGTCCAAGGCCGTCCTGCGCGAGTTTGTGACTGAGATTGAGCACATGGTCGA
GCTTAAACACCCCCGCATCGCTTCGTTCAAGGGCGCCATGTGGGACAACGAAGGCACGGAGCTCTGCGCTGTGGTCGAGTACGTGGAGAACGGCGCGCTG
CGGGACTGCATCGCCAGCTCCGTGGGGATTTCAGCCTCGCAGCAGCACACGATTGCGCGCCAAGTTGTCGACGCACTGTCGTTCTTGCATCAACGACGGA
TCGTCCACGGCCGGCTGAATTCGTTCAACGTGTTGTTGGACAAGCACTACGGGGCCAAGCTGAGTCTTTTTGCAATTTTCCACTACGTCAAGCTCTCCCC
TTTGGACTCGGAGTGCGGCGTGTTCGCGGCCCCCGAGGTGCTGCGGGGGAACCAGCCGACGGAGAAGTCGGACGTGTTCTCGCTCGGCGTGTTGCTCGTT
GAGCTCGACACGGGCGAGAACCCGGTGATCAATGCGCGCCGGTCGATCACGTCGAGACAGAGCGAGTCGCTGGCCAGCGCGCCACAGAAGATCGGCTTCC
GCCTGAGTGTGAACTGCTCGCCCGTGATGCAGGAAATCATTGGCGCGTGTCTCGAGAAGGACCCGACCAGGCGCCCGACGATGGCCGAGATCGCGCTCGC
GCTCAAGACCGGCTCGCTTGGGATGTAA