Description :
From Genome Similarity Track
Location :
Scaffold_1068:2566- 3590
Transcript NameFunction/comments
Physo_145338hypothetical protein

Sequence
1024 bases(100 bases per row)
AGCGGGTTGGTAGATGGTTGGCTGAGCTGGGAACGATTCGATGTTCACGAGTTCGCATTGGTTCTTAGTGTGGTTGCGTAGCTTATCAGAGCTAACAAAC
ACCATCTCACACGTAGAGCATTGGTACTTCTGCTGGAGCATATCAACGTTCGTGATGTAGAGAGCGTGATTCTCGGGCGACAGGATGTTGATCGAATCAT
AGTCCTTGTCCGAGCAGCGAATGCATTCAACCTTGCCCGTCTCAAAATCCATGTTGAAGACGTTGATGTTCAGCTTGAAGCACTCCTCAAGCTCATCGAA
TTGGAGAATGTCGATAGGCTTGAAATTGCGGAACAGACCCAGAGTGTAGGTGATCTCCTTGTACGAACAGTACTGCTTGAAGGCTTGTTTCACCAGAGCC
TGGATTCTGCGAGGATCCTTCTTGGCTCCCTCCTGCTTGTGATAAGCAATGCAGTGGAAGACACACTTGTTGTTTGTCTTGGGGAAGTTGATGACGGCTT
TTATCACGAATCACCTTAGGAATGACAGCCTCGCTATCACCCAGAGCATGGTCGCGTTGGTAGATATAGATTTTGAAGCCAGTAAGCCCCTTCACCATGT
ACCCGGAGCTGGGGTAGTTGAGCTTGTCAGCCAACTCCATGGAGCGAATCTCCGAGATCACCTTCTTACGAATATCAGCCTTGCTGTTGATAGCTACAGG
AGTGCTAAATACAGACGTGTTGCTAATATTCGGGTGGAAGTAGCGAGTCTCGCTATCATCAGTTCTGCTGACAAGCTTGTATCCAAGAGCGATGTTGACC
TTGAAGGCAGACTTCTGGGTTGCGAGCACGTTATCGAGCTTGTCGTAGAACTCAGCAGGCTGAATTCCCTCGTAGAGGTGCGACTCCATGTTCTTGCCTT
GGTAGAAGCGGTACTTACTGTCTTCCTTGAAATCAGCAGCCACATTCTTTTGGAGCTTGCCTAGACTGATCTGGTACTGCTTCGCTACCAATTTTTGGTT
GGTGGGGTGGGAAATGTTGTATAC