Description :
From Genome Similarity Track
Location :
Scaffold_36:25659- 27220
Transcript NameFunction/comments
Phyta_totarag1750hypothetical protein PHYSODRAFT_353701

Sequence
1561 bases(100 bases per row)
AAGTTAGACCTGCGGGGCCTCCACCATGCAGAAGCCctcgctgcactcgctgctcttggactgcagctccagtgcgtGGCTGTTGTCGACGACTTTCTCG
GGTGAAACGGCAACAACATGACGTCGGGCAATGCGCGTTTCGCGTATGAACTCGCACAGCGAAATCTGGGCCAGGTCATCGGCCGAGcatttcttcttcg
ggtTCTTCAGGACCATGATCTTCGTGTTCAAGCGGCGGTTGGCTTCGGCTGAATAAGGAAGGCACATGACATTAAATTGCGATCATCGACCAGatcaaag
aagaagaaaaaaatgaagACAACGCACTCCGTGATCGCACGCCATAAAACTGGCAGACGCTGTGAATGATCAGTCGATGGAAGGCCGAGTCCAGCAGAGG
CAGTATCAACCGCACATCTTTCTCGCTTGCTTTCATCAGCTCAATCGGGTGCTTTAGCGTGCGGAACAGTGGTGCTGCGATTTCCAGCTCTGACGGAACC
tctcgccactgcagcaaataGCAAGTAGCGATCTCTTTAACACATCGTTTAATGCCACGATTTCCACGTATCCAATCCATACCTGGATGAAGTGCAAAAC
CACGTATTCCACTGCTTCAATAAACGGTGCGAACGAGTTGAATGACCGCAGCATCAACGTCCGCGCACGCCGGTCGACACGAGTAAACATTTGCTCAGCA
TCTGGCAcagccaccaacaccaccaGCATTAGTTAGACAACAGCACCAGTGCTCTAAAGAGCCCAACACTAACTCACCGTCCCACTCATCTTTGCGTCGA
TTGCGTGGTGCATGGGATCGGTTGTTCTCACGtgcgcctcctccttggcggAACTCCGTCTGCAAATCTTCATTCTGCGGCTCTGCCAGCTTCTGAAAGT
TCGAtctgatacatgtacagtacacgtCTCCACGGTCAACAGCATGTCCAGCTCACCACTCGACTAGCAGAAAAGCACAACATTTCTGTTCTGTACTCAC
CTCCACTCTACGTTGATGTCCATGTGCTCCATCAAGTCTTCCAGCCGCGTGGATGCCGCGCGGTTGCCGAAATGATGGTCTTCACAGTACAGTACAACAG
AATGAGTCTCTACACCTAGAACCTCCACTCCTAAGCTTCTTTCTCACCGTTAAaccaccgctgctgcttgcgcacgCCCAGCGGCAGCTCGTTGGGCTTG
GACAGGTACCCGGCCGAGCGGATGGGGTGGATGTTGATCAGCCTCTTGCTGCGAGCCAGCGGTGACTCGCTACGTTTCTGCGGCGTACGCGCGCGACTGG
AGCCGTTCCCGTTGCTGCCGGAGCGCTCCACGCCTGCgatcgtgctcttcttggcggcgccgtcgtctGCGGCCGCCTCCGTGCGCAGCGGCGCGATGGG
ACCCTCGCCCCAGGCCATCTCCAACTCCAGCTCGCTCCCGCACAGCGAACTCACTTCGGAGTCGCTCACATCCGGCACCTCCGTCGCGAGCTTAATCACA
TGCGCCATGGTCATCGTGTAGCTGGCTGGCTGGTGGCTACTTCAGTCGTGTTGGGGTTATT