Description :
From Genome Similarity Track
Location :
Scaffold_223:25651- 28837
Sequence
3186 bases(100 bases per row)
GATCTGCTACCAGGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAAGTAGGGGGCAAGATCAACAATGGAAAA
GCCATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGACACCGCCTTTGCTCGTAAGGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCCAGAT
TGTGTTGGGATTGGTGAAGACGTATACCGTACGAATGGGGGAACACGGATCAAGATCACGCTGGCAGGTTGTTTGGTATACTGGTTCGATATTTGGGTTG
GAGATCTCGCTGGTCAAGACGCCATCCTCGGGATTGATTTCATGGCACCAGCTGGGGTAAGGTTGGATCTGGCGGATGGGACACTGTGTTTCCCCGACGA
GATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATGAGGGCGGATTAGACGACCTGGAGTGAGCCCGGAGAAACCTGG
GAGCTGCCAGATCGATTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACAGTAATCCAGGGACCAGGTCGATCAC
AATACCTCCAGGTCACGCACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATCGGACTATGGTTGGCGAAGGACGGTATCCCTAGACGACC
TGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAAATCGAATCTCTCGGAGAGGTGAAGCTCCCG
GTGGGACCAACTGACCCTTTGGTAAATCGGCCTTCATATCCCACTCCGCGAAAGTTCCTGCAGAGGGATCGTCGGATTGAGGTCCAAGCGATGGAGGTTG
GATCCAAGACCGGGGATGATCCCCAGAGTCGGCCTCTAGATAACGTAGGGTCGGTAAATGAAGGATCGCAGAGGACTGAAGCCGGACCGCCAGATCCCGC
TGACCCCAGAGTGGATCCTAGCTTTTCATGGGGCCAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCA
CTAGAGGATCAACTCGATCCAACTGGTGGCTTATCCGATACCAGGGTACCTGATCCCGCGAAGACAGAAGGACTGACAGGTGAAAGAGGGTCGCGGTGCT
TGGACCCAAGGGTGGACCCGACGAAGACGGGAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTCGGGGATGGCCTGGCGGT
AATCCCGGAGGTACCACTGACCACAGAGGAGATCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGAGCCCGCGGAAGTGGATCGGTTACGTCAG
AAAATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAAC
CGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATTATCAGTTTCTCAAC
GTCGCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGTGTGGATATACGTCTGTGCATTGATTACCGGCTAGTTAACGGCCTGACCCGATTG
ATGGTATATCCAATGCCTCTAATCAATGAGCTATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTTGACATGGCCAGTGCTTTCTGGGTGGTGA
CTATGACGGATCGAGCTCGCGCAATCTCCGCATTCATCACCCCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAGCGCACCCCAGAT
CTACCAACGCCTGATCGATAACGCCCTCTATGGATTCACCCGAATACCGGAGCCCGAAAAGGGTGGATCCGGGGAAGACCATACGGAAGTGGATCCATTC
GAAGCGGGGGAGCCAGGGGATCCTGGGGCCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGGAATCGTGGGATCAGTTGT
ACGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGAATGCGCAAGGTGGATTATTTATG
CCATCGAGTCTCCAAGAAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCAGACTTGTCCTTCCCACAGTCGTTACGTGCGATGCAATTCTTC
TTGGGCAGTTTGAACTACTACAGTCGGTTCATCAAGGATTACGCACTGTTTGCTGCGGTACTATATGAATTGAGAGAGGTAGTATTTGCTGCGATGACCA
CTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGTCCTGGAGATGTCAGATCCACGAAGGGATCCAAGTAGTACGACGCCAGAAGAGGACCTAAAACA
GGAGCTGGATCCACCCCGGGACCAAAGGAAAGAGGATCCAATCTGGATAAAAACCACGGATCAGAACCCGGAAAGGGTGGAACCTCGGTGGATCCGAGCT
CAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACACCCATTCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTG
ACTGGGCCGTCTCAGCAGCTCGGGTACAAGAACATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGG
AGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTACTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACG
CTAGCCTGGCTGTAAAAGTCGGCCGGGTTGCAAGGAGTGGGCAGCTTTACTCTCGCTTTGAACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAG
ATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTTGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGA
TCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCTGCATAGTGCAGGCGTCGACGTGGTACT