Description :
From Genome Similarity Track
Location :
Scaffold_47:256502- 263097
Sequence
6595 bases(100 bases per row)
GCTGCAGCCACGGGAGTAGACACGTGTGGTAAAACTCGTTCAAATGGTGTTGAACCACACACCATCACCAGGATTGGGGGAGTTGCCCTTGTAACTGCTA
TGGCTAGATGAAGACGATGGGACCCGGTTTTAATATTGCAATTCCGGGCCCTGTAAAAAAAAAAACTCTTGAGTAACCCAATCCACCCAGCGAGAGCATG
CCGAGCAACTGCAGCTAAAGCACACACAGACGCAGTGCCCGGGCGAACGCGGCGGCAAGGGCTGCTGGACGCAAAGATCGAGCCAAAAATAAAGGAACGG
CCATGGCTCAGTTTGACGTTGGATACTACATGTTGTATGCTGATGTATAACAACGCCTATGTAGAAAATTGCGAGTGAAGTGGTGTGGGCCGACGGCGGT
GGTCTTCACCACGCCCAACTGGATCTTCGAGATACAAAGTTTGTTGACAGGTGAGCGGAAAGAGATTCATGTTAGCCGTCTAAAGTTTTCTACAGATGCA
TTTCTCAAGGTGACTGGGGACCTACTGCTACACGTGGCCCACAGCACTCGTTAATACTTTACTAGGCACGCGCTAGGATCAACAGGAGAAGCGCCACGTG
ATAAACCCTTTAGCTCCTATGCTTCATAGCGGTCCCCTTAGACCTCTACCAGGTTTCGTTAACGATTGCCATTGGACAATATTCACTAGCCCCTACCGCA
GGTCGGTTCGTAGAGGTCCATCCAGACCTCTATCATACCATCACCTATGTTTTCGTTACTGCCTGAGTGCACTAATATTAGCTCGTTAGAGGTTCCTTCC
CTCCTTTGCACGCTCAACGCAAAACCGACACTGATGGGGACCTGAGAGGGGACTGGGAGGTTGAAGCTGACGAAGAAGACGACTGCGACAGCGTTGTTTC
GGACGAAGGGGTGTCAGCGCACGCTGACGAAGGAGGCCATGATGGGTGGAGGAGGCGCTCCCGCCACCAACGCGTCCGAGCGCCGCGCCATGGCCGAGGA
GTACATTGCCTCACTGCGCAACAACAGTGGCCTCCATGTGATGATAGCCGACCAAGTGGCGAAGGCGTACGACAAGAAGACAGAGTACGGCATTTTCTCT
TCATTTTTTACGGCCGTGTTCAAGGAGCGACTTCGGAAGTGGACTTCGGACGTTTTAGTGGAGGAAGGGAACGCAAAGATCACTGAAGCGAGCGAGTTCA
ATGCTTACTTAGGCCTCGAGATCGCTATGAGCATCTGCCACTTGAATGAGATAGCAGAGTTCTGGTCCAAACTCCGCTTTCTTGGGCAGCAGGGATTCAT
TGAGACCTTGTCTAGAAACCGGTTTCAACAGATTCGAGGTGCCCTCACTCTACATGCACCTCAGCCGCCATCGTTCGACGAAGAGCGGGATCCTCTTTGG
CGTTGCCGTGGAATAATGGAGCATTTCTAGCAACAATTTGCAGAGGTTGCTGCTCCTATTGGTGTGAGTAGTATTGACGAGATGACTATGCTGACGAAGG
AACGGACGCGGGCAAAGACAAATATGCCATCCAAACCCGATAATTACGGGCTTCGCTTTTATGCTGTAGTGGGGTGGAGCTCGCTGTACGTGCACGCGCT
ATGGAACAACTCGTCCGGCAACAACATGCCGTCCACGCCTGCGGAGCGCTACACGAACCTGTTTCAAACATTGAGGACACCATTGTACAACACATTGCGG
GTGGAAGATGCATCCATCGAGCCGGACACGGTGGCGACTATGTGGATTGCAATGACCGGCCATCAAACTCGTGCTCTGCAATGGATATCGCCTTGTTGTT
TCGGATAACGTTTACACTCGTCACACATTTGCTCAAGCGCTGCTGAAATTTACGGACGGTGAGATGCACTTGCTGGGGACAGTGCGTATCAACTTGGTAG
GCAAATTCCTTGGCAGCGCCAAGAGTGGCGTGGCCGGAGAGGCAGGAACGGTATTAGAGTATCGTTCGGTATATATTTGTGGGATTAGAGTGCCCCTGAG
TGTATTAGTCTACCTACCGAGGTTTTACCTTGGTCCCCCTGTATAAGGCCTAACACGCCGGTACCCTTCCTTTCTGAGGGACTGCAGGGGGGTTGCGCGA
AAGCGCTACATAGGATCCTAGCCTTAGCTCGTGGCTAGTGGTACAGGTTTTGGGGTTGACCGAAGATAACCTAAGGTGCACAGAGGCGCTTGCAACCAAC
CCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTTTTGATCCAATAAGCGCTTACCTTTGCGGGTTAGCGTGCTTTTGGTGTCTCTAATACCTTTTGGTAGA
AGAGAATTTTAGTGGTATTACCACACCACACCGGTTGATCGTGTGGATCAGCTGCGCAGCACTAATCCAATTAGTCGGCGTGAAAATCGGCTTGGAATGA
CGATGCTCACGTGGCTAATGGGTCTGGCAATAATAAACGCACAAACGCTACTCAGCACAGTCAAACCAGACGCAGCAAAGGGTGTATCCTTGCGTGAATT
CAAACGCAGGATAGCCGACGTACTCACCAGTTGCGAGAAGCAGAACAAGCGTCGGCGTGAGTTGCAACAGAAGCAGCGCACCACCGAGACGCAGGAGGAG
ATAGTTGGCATGGACACGTCGCTCCAGATGATAACGCCCAACACCACCGAGCACAGCAATACAAGCTACTCTGTCATCTCTGCAGCGTGCGAAACATCAA
AAAGAAGTCCCGATATGAGTGCACGAAGTGTGAGGTTGGTTTTCACGTGGAGTGTTTCCCGGCCTTTCACAACACAGACGCGCTCAAAAACTCACCTTAG
CTAAGGTCTGCACTAGAAGCGCTCTGCCGAGCCTCAACCGACGACCCCGTCATCTTTACACCCAAGAAAAGCAACAGGACAATCACACCTATTGAGAAAC
TCAAACTACCAGAGCCATAAGCACAATATGCATCGTTCATACCTTTGGAGAGTCCGGCCAATACTTCATCATCTTCTTGGCCACGCAGTGAGGTACGGGT
CCGCGCAGGTTGCCGGCCTTCTGATAGAGATAAAGGCGACTCAACTATCCCGGAGTGCGGCAAGGAGACGCGAGCGTATGACATGACACCCTCCAACAGA
TGGCCTTATCGCTTGGGCGGTGGCGACCGCAGCGCTAACGAAGCGCTAACGCTCGGCTTCCCGAACAAAACGCTGATCAACGCGGTTATTCATTCGCGTC
GTTCTGTACATCCTGGGATGGTACCCTCTTTGGGCTTTTTGTAGAACTTGACGATTGGCCGCACAATTGCTCTGCGAATGCACAGGTGCTATCTAATGTT
CTTCTCTATCAGCTCCTCCTTATATATACAGACTACATCGTCCCATACGTTTTAAGAGTACTCACGTCTTGCTGTACGTACCTTGTAGGGTCTAATCGGG
TGATTATAAGGGCAAGTACTAGTATCGTAACTGCTCATTATCTTTTCTCAACTCTAAAACGATCAGTAGCAGGAAAAATGCGCTCTGTATGTCCCAACAA
TACTTTTACACAAAACAAACCTACATTTGCATGGCATCATTGTACAAAAAGGTTCAGTAACACCTGAGCATGGTAATCCTAACTTACTCATCCAGTCACT
TACTTACTTACTTATTAAAGTCATTGGTTCATTTTAAGCGTCATTCACTTATTGTAATAACCGGCCAAAATGCCCACCTGTAGCAACCGCTTATTAGATC
TCAATCACCTAATTAATCAGAGTATAAATCAGGGTATATATCGATTGTGATCCATATGCATCGCTAGGCTGCACGATTGCCCAGTAAAAGGTAGGCATTC
TGCTCCAAACGCGTCTGTATCGACTGGTTTCACATAAATCGATCGTACCCACTCACATATGCATCGCAGGGACGCGATCGATTTACAAATCGATCGAGCT
AAATTAGGGTGCTAATTAATCGTTTTACGACCAAAATAGGCAAAAGAAGCGGTTTTCACAATATTTAATTATTCAGTTAAACTAGATATCATTGAGTTTC
ACTTCCTTACGTTGTTCTTAAAAATAGTTATCGAGGCGTGCGTGGAGTGGCAACAATCATCCTTTTCCAGTGTAGCATGCGCACTAGAACAATGTTATTC
CACTATCCCGTGAGGCAGGTGTGTTACGAAAAGTTGCTCCAGGAGGGGCTCGAACCCTCGACCTGCGGCTCATAAGACCACCGCTCTAACCAACTGAGCT
ACAGGAGCGGCAATCATAACGATTTTTGTCAATTTCATACCACCCTAAATTGATTTTTGTGTTTCAGCTCACACTCACAAGACCGTTGGAAGGGGTGCAA
AATTTGCCAGAACGTTCTTAATTAAACGAAGAAGGGTCTGGTGGCGAGGATGACAAGAGAAATGCGAGTATGAATTGGTTAACTCTTCCGACGATTGCTC
ATCCTTCATCGACGAGTATGTAATGAGGTATACCCTCATTCTTTTTCTTTAGACTAAGGCGTAGGATTTTACAAGTTTTACGTCATAGTTTCTTCGCGCA
AATCATATAACTACCTGTTCTAACCATTTGACGTTCAATCCACACACACACACACACACACACAACTTCAGGACACCATATTCAGCCGATTTATCAAACC
ATGTTCTCTAAGCGCTTGCACGTAGAATAAGACAATCTACACGACGTCGTTAACCTACTGATAGTCTTCTGATACTATTGTACTCCACATTATTCATTGG
ACAAGCCAAGCAGAGCCCCGCAAGCGGGGCTCTTTGAACAGGTCTAAGCCAAGCACGAGAGGCTGCCCGCCAAGCGAAGGGAGCCTTCCTACACAGCGTG
GATGCCGACAGTCTCGCCGCGCGCCGGCGATTCTCAGTAGGCTCCGACAAGCCGCTGGAGGGGGGAAGGAGACAATGGAGGGGGCGAGGGGAATGTACAT
TTTTGTCACGAAAATGAGTGCTTACAATTTTATCAGCCACCCCCAGAGGTGACTGATAAAATTGTAAGCCATGAGCAGAAAAGCTCGAGGGAAATGAGCA
TCAGCAGTGCGAGATTGTGAGCACGTTTTTTTCAAGTTCGAGTCCCCCTATTATTAGTAAGGACGACTTGCAGAGCCAAATATATGCATCGGATTTAGGT
TTGCTAATCAGCCGATTTAGCCAGAGCCGGCCGATTTGCTTACTATTCAGACGGAAGTCGATGTGCAACCGGCATTCGCTCCTTGTAGGCAAAATCAGCC
GCGCAGACAACAATCGTTGCAGTCGCTCTTGGCTAGGTATTATAGTCAAGGCTACAATACTAACAGCACAACTATAATGACCCGGAAAAGCCGCACGCTA
TAATAAATGTAACTGAGATAAGCAAGCGACGGATTAAGGTGCGGTGTTGCCGCTGCACTAGGGCCGAGGTGGTATGTTGATCGAAATAGCTAGGTTGCAC
ATAATTACTAGACCGATGAACGATTTATAATCCGATTATAATTGAGACATCCTCAATTTAGAGGCCTCTAAATCCTCTGTGAGCGATGCGTTACTGGTCA
ATTCAGCAGGACACACTAATCGGTTTTCACAATACGTACCGATATTTTTAAAAATTGGTACATATTGTGAAAACTGATTTAAAAATCCGATCAAGATAAA
CAAATTAGCTAACAAGGCGTGGACATTCCGACCGCGTTTCACAATACCTCATTATATACTCGTCGATGAAGGATGAGCAATCGTCGGAAGAGTTAACCAA
TTCATACTCGCATTTCTCTTGTCATCCTCGCCACCAGACCCTTCTTCGTTTAATTAAGAACGTTCTGGCAAATTTTGCACCCCTTCCAACGGTCTTGTGA
GTGTGAGCTGAAACACAAAAATCAATTTAGGGTGGTATGAAATTGACAAAAATCGTTATGATTGCCGCTCCTGTAGCTCAGTTGGTTAGAGCGGTGGTCT
TATGAGCCGCAGGTCGAGGGTTCGAGCCCCTCCTGGAGCAACTTTTCGTAACACACCTGCCTCACGGGATAGTGGAATAACATTGTTCTAGTGCGCATGC
TACACTGGAAAAGGATGATTCATGCTCTTTCGTAAGACGTTACTTAGCCCCAGACAGCCTGCCGTAAGACAAAGCGTCTTACGTTTTGCAATCAACGCAT
TTTGGCTACATCTTGGTTTTAGTATACCAGTGGCTACATTGTATTTTGTCCGTCAAAACGTAAGACAGTTTGTCGGACAACAATTTGCACCATGCGATTG
GCCAAAACTTTCAGAGGGTAGTGTCGTTGCGTGCGTTCCTCCTCGTGCCACCTACAGTCGAGCCGACGAAATAAGGCGCTCACATGTAGTCGGTAGTGCG
GCCCTACTGCCAACTACAATGTACACGCTTGTTTGAGAATGGTTAAGAAATAAATGCACCCGAACCATTAGCCCAGCTTGACAAACAAAACGTTCAGGGC
TTTATAGTGAATTCAAGTTAATGCATAACCAAATAGAGCCCCTCTTCCTCCGGTAGTGCGGCCCATGAACCCTGTCGTGTCCTCTGAGGACGCCTCCGAG
CGAAGCAGTGCACGACGAGCGCGCACACATGCTCCGCACCGAGGCGTTGTCGGAGGGCGCGAGGGAGTAGACAATCAATACATTATGGGATCTTA