Description :
From Genome Similarity Track
Location :
Scaffold_117:2565- 30549
Transcript NameFunction/comments
Physo_142542PREDICTED: similar to fat-free protein
Physo_142543hypothetical protein
Physo_158561DEAD box RNA helicase (Hca4), putative
Physo_142546PREDICTED: similar to RAB6 interacting protein 1
Physo_122917PREDICTED: similar to RAB32
Physo_142548hypothetical protein
Physo_109480ubiquitin-conjugating enzyme
Physo_142550syntaxin 7-like protein

Sequence
27984 bases(100 bases per row)
TTGAGGATCGCGATGTCTTCGGAGGACCACGGCATGTCCCGCATGCAGGAGCTGCTGAGCAGCTACTACGGGCTGCAGGACCAGGAGAGCAAGCAGGAGC
AGCTGCGCAACATCGACTCGCCGGGCTTCGACCCCAAAGTCTACGTCAAGGTCGGCGCTTGGCTAGAGAGGAAGGCCACGTGTATTCCTGAATATGTAAC
CCCCTGCGTACCCTCGTATCTGCAGGAGCTTCTCGAGAACCGCGGACTCAATGAGCTGCTCACGACGGACGACCAGTTGATTCGCGAGATCAAGGAGCTG
GACACCAACATGCAGATGCTCGTGTACGAGAACTACAACAAGTTCATCAGCGCCACCGACACGATCCGCAAGATGAAGGTGCCCACAATATCCAGCATGC
AGCTTTTCAGAGCGGGTTGCCGGCTTAACTATGTCGTTTTTAATGCTATTTTATGTATTTCTAATGCTGCAGAACAATGTGGCGAGTATGGAGGAGGAAG
TGGGTCGCGTGGTGAAGAGCATGGACACCATCACGGCCAAGAGCGAGAGCATCAATGTGGCGCTGGCCCCGCATCGCTCCAAGGTGGAGAAGCTCATTGG
CGTACGACGGTTGCTGAAGAGATTCGAATTCATCTTCGAGCTGCCGCAGAGATTGAATACGTAAGTGCTGAAGGAAAGGAGTGTTGGAGGCGAAGACAGG
AGCTGACGATGAGGGTGTTGTTGTAGTGCTGTGAAGCAGAAGGAGTACGCAAATGCTACCAAGTATTATCTGCTTGCACGCCGAATTCTGGGAAGATATG
AACATATCTCGTCGTTCAAGGTGAGGCTTGATGTGGAAGAAGAGCTCGACTGGATCCGCGCTGACATTGTTGTATTTGCCGTAGACGATTCAAATGGAGG
CCGAGAAAATCATGCAGCAACTTGAGCGTCTGCTGAAGAAGCGAATGCTTGACCGAACGCTTGGGTCCGAAGAGGTAACTGCATGCTTATGTATGGCGGG
TAGTTGTTATCATGTCATTGATGGAGCATGTGCCCTGGTTTGCGTAGCTGTGTGAGACGGTAGTGCTGTTGCATCAGTTAGATGCGTGCAGCGACGAGAT
CCGAGACCAGTTTCTTGAGTGGCACCAAGCGTATTTTGAGCGCGAGGTAGCGGTCTTTAAGGTACATAAGGCTTCTACTAGTGTGTGCTTGCGTCCATGG
TCTTACGGTATTATTGTGCTGCGTATTTACAGGCTCGAGGCACTAGCGATTCGGTGCTTGCTTTTCTGCGGAGATTCAATGAAGACGTCCTGGCGAAGAT
GGCTCGAGTATTCTCAGTATACAAGACCCACTTCATGCCTGAAGTCGTGGCGCGCGAGAAATCATCGCCATTACGAAGATCTTCTGATGCTGTCCGAGAC
GACTTGTTCCTCAGCTTTGTGAAAGAGTTGTTCGGGCTGTATCTGGGCGAGTGTGTTGAACAGTTCCGTCGCCCTCATTCGGACTTCGTAAGTACACTTT
GCTGCCTTATATTCTTGGGACACCAACGCTAATGACAGTTCATGCTTTGTACAGGGTTCGACGGAAGAAGTCCTCGACATGCTGCAGGATGACGATCTCT
CGGCAGATATTGTCGATAGCGAGTATTTTGTCTTCATGCGTGTGATGAAATACTTTGTTTCGCAAGTGAAAGATGTGGACAGAACGATCCCGATGTGCGG
TCTCGCTGCAAACGCTACTGAAACCGTCGAGAGCTGCGTGCGGTTCCAGATTGATGGCGTATTTCGGAAATTACGCGAAGATACTGGAGAGCTCTTTGTC
ACTTCGCACGAGGATGTGTCTGGGTTGGCTCGTAGCTCACGCGATGGTGGGCAAAGTGTTCAGCCTCTAGCGCACGAATCCGCAAGGACGTTTACCGACA
TGATGCAGAAGGTGCTGCAGCAAATGGAGCCCATGGTGCAAACAGGGTTTGCGATTCTTTCGGAGATGAGCAGACTTTTCTCCGACTTGGTCCAGGTAAG
GTATATCCCTCTTTGCTGCTCACGCGAAACAATTTCATTGCTAACAAGTATGATGATATGACGATTCCGTTCAACATCTTTGCAGAGTCAATTTTATGAC
TTCCTGAAGTGGTTTAATGCATCAGTACTCCAGTATGCGGAGCCAAAGCGCGCATTCGCACAAACGGATGGACAACTCGGAGCTCGGGGCGAAGAGCAAG
ACAACATAGCGCTTCCGTGGCTGGAGCCCACACCCCAGTTCTTGCTGTTCCTAGCCTGTATGTGCCAAGATCTCTCAGCTGAAGGCATCGGGGAGTGCGT
ACGCGGCCTCATCGAGTGTCTGCCAGCACCTCTGTCTCCATCCAAGACTCCTGCTGGTGACCCGATTCGCAGTAATCGCATGCGCCAGCAGGACGTAACG
CACATGATCGAAGTGACCCGTGAGTCTGCTGGAGAGTTGTTGCAGCACGTTGCGAAGCAATATGGCAACCAGTTGTGCGTTATCGTCCACAATGGAGTTG
TTGCCACATCATGGGCTGATATGGACGAAGAGCCGAGAAGTGTGCAGGAGATGATGGCAGCGGTCGTGCAGTCCACCTTCCGCTTTGGCAAAGAAATTGC
ACTAGCACTTGGTGATGAACAAAGCGTGTTCATTGGGAACAACAGCCGCACGACAAGCCGCGACTTCCGTCGGTGCGCCAGTGCGCTCCGTTCTCGAAAT
GCTGGCGTTACAGCAGCATCCTCAGGGATGCAGCTTGATGTGGATCGGATTTTCGCGCGTAAGATCCACATTTTCCCGTCCCAGTTAGAGCTCACTGCGG
ATTCGTTTGTCCAGACGATGCTCAAAATGTGCATCAAGGCCTTCAGCGAGTGGGTTCGGCAGCTAGAGTTGTCCAAGTTCGGGTTGCAGCAGATTCAGCT
GGACGCCGAGTTCCTTCGCAGCACACTCATGCACATTGTGGTGGCCGGGGAAGCAGAGGAGGAAGTGGAGAGCCTGCTGTCTGATTTGCTCTCGAATGCT
CGCGGCCGTGCTGTCGAGGATGTGTTGATGGATCAGAGCAACGTTGTTGCTATCGTTAGCACCAAAAGCACTCAAGTTTTGTCTCGCCGAGGATGAATTC
GTGAAGGAGTGCGCCGATGGATGCAACCAGAGTGTTGAAAACTCAATATGCTCATTAATCTCTAACTTTGTGTTTCTTTCATCTAATTCTTTTGGGATAA
ACTGGAAAGCCGTCTTGTGCTTGAAGAGTGTTCAACCAAGCTGCGTGAGCTGTTACCGCGCACGTAAACCCTCGCCAGCTCTTCAATTTCCTCTGCTTCA
CGCTGGAGCTTGTCCAGCTCAGCCTTGTAGCGCTCTCGATTGCTTTCCAGTGAGTCAGCATAGACCCGAATGGCAGGACACAAGGTGGCCAGCGGCAGCC
AGATCGGGCGCAGGACATAGTTGATAAAGTTGAGCTGTACGGTGACCCGTGTCTTGGCGTGGTGCAGATTGGTCATGAACGACTCAACCGGAACGTGCAT
TTCGGCTTCGTTCTTCGCTTGCTGCTGGAATTCCGAGAGCACGCGCATGCCCCAACGGACTGCCTGCGTGTACGGCAGGGCCTGGCCAGACAAGTCGGCT
GCGTGGATGATGATTGCCATGAATACGAAGCGATGTTTGCTTCGACTTCGTCTCGCACCTCTGCCCCCGTCGCTGTTAACAAGAAGGTGGCGTTTGGAGA
GCCCTTCCAGGGCCTTGCACTTTTCGAAGTGCTTTGCCATATCTGTCGCGAGAATGCAGTGGATGAGCAGTCGACGCACATACACGAAGCAGGCGCGCGA
GGGCAATCGTGCCAGAAGGTTTGCTCCCGGATGGCTCAAGATAACGAAGGCCACGCGGCAATGGTGACGCTCAAGTACAGCATCGTCGTTGTGCGTAAGT
GCGAGCTGGCTGTGCGCCTTGACCTCAAAGTCGTTCGTGTTGCCTGGGTGATCCAAGTCGTGGCACAGCGCAGCTACCAGCATTGCGAAAACTTCCACCC
GAGCGAAGTACGAGTTCGCTACCCCTGATCGACGCAACAGGCAGTAAGTTGCGTGTGTTACTTGGAAGGCGTGTTGGAGATTATGAAACGCGTTGGGGCG
GTAGTGCGAGGCCACGTGAGAGAGGAACGTGGAGAATGTTTCCTGGGCAACCTGGAAGCGTTCCAACAGCCCAAGCGACCGAAAGAGCACTGACGTCGCT
GCGAATATATCGGGGTTGGATAGATCCAAGCAGGAGAAGTCCCACCGGGTGACGTCGCCAACGCCGATCACGTGTCCGCTCTCGCGTGCAGTTGAAATTC
GTCGCTGAGGAAGCCGCTGTGGAAACGGAATCGCGGCGAATGGTGTTGGCTGTTCTTCCTCGTCGTCTGTGTCGCCGTCACAATCATCGTAGTCGCCCCC
GCCTGCTTCATCCGCGTCTTCCACGTCGTCAGGATCATCAGCGATGGCTGCAGCTGCTACCTCTTCAAGCACGTCGAGCTCACTAGACTGGCAGAACTTC
TGCACGATTGACGAGATGATTTCCGGTTCGTTCAAATCGTCAACTGCTGGCTGGTCCTGCGTTTTTGATGGATCGGTAGATTCGGTCAGAGACTCACCGG
GTGTCCCGAGGCCGCAGTCCGACACCACCTTGTAGTACGAAATGTCTAGAGACAATCGACCGAGCGCGAATTGGATCTCCCGACAGTACTGGGTCATGCA
ATCCGCGTCGCTGGTAGTGAAAGGTACGTGCTGTCTCGTCACAGGGGGCGCGTCGTCGTCGTCGGTCTTCGCGTTGTTGGCCTCGTCGTCGTTGTCGTCT
TTCTTGTTGATAGCCATCACTACTGCCACGATTTTGGGGTTGGTGGGCGTGTGATCCTCGAACACGGGCATCCCCAACACGGTTGTGGTGCGGTACCCCG
TCTTTCGATCCAGCGTTGGATCAAAGTGTGGGTGAGTGTATGCGTCGCGCGTGCATATCGACCTCCCGGTAGTGGCGATCAGTCCAGAGAGTCCATTCGT
GAGCGGCATCCTCACGCTTTCTCCATCTTCTTGGATGATCCAGAGCTCTTTCTTCAGCGGGTCCACGAGCAAGAAGCCGAAGCGGTCGCAGTGCATAAGC
TTTTTACCTTCTGCCATGACCACGCGGACGAATCTAGCAACGGAGGCTGCGGCGCTTGTTTCGTCTTCAGCTCCCGACGGACTGTAAGCGCGCTCACCGT
TATTATTCACGAAGTCGGCGAGTTGCAGCCGCGCTTCTGTCAAGCGCTGCGACATCAGCACTGAACGGAGTAAATTGGACTTGTGCAGCGAGATTCCTGC
GGCCTCCGCGGCGTAGTTCAGGTACAGCGCGTCGTCGGAAGTAAACTCGTCGCCGTCTACCTTGTTAGTGGCGCAAACCACGGCCAAGACATGTCCGCCG
GCATCTTTAACTGGAGCACAAAGCACCTGCTTCGTCTTGAGCGACGTCCACAGCTCGTCGAACTTCGGGTCGAAGGCGAGATGGGTTGGTGCGGAGTTTG
TGAGCACAAGTTGTCCGGTCCGCATAACGACACCTACGATACCGTTGTGCGCTTTCAAGAATGCCTCGTCATACCCGCCATGCCGGAGGTGAGAGTGGTG
TGGCCTTTCATTTGGCTTGTCCTTCGCTTTGGTTTTACCTTTCGACGCGTCCCTGTACTCGGTGACGAAGAGGAAAAACTCTTCCGTGCCTTCGTCTCGC
ACATAGAGAGCGATATGCTCTGCGCGAAGCAGCTCGTACGATACGGCGATGATCTGGTGAAGCACGGCCGACGAACTGAGCTCAGCAGCGATGTTCCGAT
TGAGCTTCAGAAGACACTCGATGCGGCTCTGCATGGCCTGGTGCGCCTTGGCCAGCGACAGATTCCACAGCGCCGTGCCAGCAGTGACGCAAATGTAGTC
GAAGCTCTCCTTGTCGCGTGGGTCAAACGCTGCTTTCTCTTGGTTTTCCTGGTTTTGCCCAAGTTTTGTCAAGTCGGACCGAGGAGTTGAAGAAAACCAC
AGAGGTTCTGGTGGAGGAGCTGGAGCTGGCAGGAGGCCGAGCTCTGGGAGCTGTTTGCGAGTGATGACTTGGAAGACGCCGACCAAAATGCCGTGGACGT
TGAAGATGGGCGCGCAGAGCAACGCCTCGGGCTCAAACTCCAAGAGCTCCATTTGCTCTTCGAAGACATCGACGACTTCGGAACCGCTGACATCCGCCAC
CTCGAGAGGCCTCCCAGTCTACACTCCATCAACAACACGGACACAGTACAAAGCGATCAGTGAGCCAAGCAGTCCCTTAGGAAATGGCAAAACAAAATCT
CACCAGGACAACGCGCCCAAACGTTGTGGCCGAGTCGACAAGCACACTGCCCTCTTCAGTAAGGTAGCGTTTGCCGTGCAAATCCATGGGAGGGTTTGAG
TACAAGTCCACGCGGTCCTTCTTCTCGCTGAGGATGCCGACCGTGTACTTCTCGGCAGGGAGCACATGTTGCGCAGCTCGAAGCGCATTGCTCACAATGT
CCAGACTGTCCGACGCCTGCGAGACCTCGCGCATGGCGTCCATCAGCGCACGGAGCTGCAAAATCAAGAGCAATCCTGAGTGATATCAACAGGGCACGGT
GGTTATATGTTCAACGTACGTTCTCCTCTCGCTCAGCGAGCTGGTTCATTGTCTCCGCCTGCTCTCCGATGAGGTTGCGCATGCTTGTGCCAAACATCTC
ACTCTTCGGTCGCATCCGCTTAGGCGACGCAGGGTTGAGCAGGTCTCCCGGTCGATACGGACGGTGCTCCGCGCGAGCGCCTGTGCAGCAGTCGGGCTGG
TGCTGTCGCTTGAGCAGCTTGATCTCGAGCTCCCTGGCCTCCTCTTCGGACTGCGCGAGCTCCGCAGCCAGCCGGCGGTTCTCATCCAGCGCCGCCCTGG
CGCCGTCCATGGCCGTCGTCAGCTCTCGCACAGGCACACGCACCAGCTTCACCTGGTCGTCCGCCATAGCTGCCCAATGATCAAATAACCGCCCACTTCG
ACAATCGGGCTGGCTGCCTCGTCACATGGCTACATTTTCAAAGTGTACCACCTATTTGGTACATCGAATACAGCCCTTTTCCAGCCATTCGAAGAGCTCC
AGAACTCAAAAGGTCAACGTCACTTCACCTGTCCACCCAGTTCGTCCGTTGCCATGGCCTCGCGCGCGTTCCGCCAGGCCCACAGCCGGCCGAATGCCGC
TCCCGTGCAGGACGAGGAGGCCGCAGCCGCGTCCGCCGCCGCCAAGCTCAAGCAGAACGAGCGCGAGCGCCTGGAGATCGAGCGTCTGGAGGCGCGCATC
GCCGAGCAGACGCCGGCGCGCGGCTCGCAGCTCGGCGAGGCCGCCAGCTTCGACTTGTTCCCGCTGTCAGAGGCCTCGCGCCGCGGACTGCGCACCTGTG
GCTTCACGGCGCCCACCAAGATCCAAGTGGGCGCGCTGCCGCACGCGCTGGCGGGGCGTGACGTGCTCGCAGCGGCCAAGACCGGCTCTGGTAAGACGCT
GGCCTTCCTGCTGCCGGTGCTGGAGAAGCTCTTCCGCCTCCGCTGGAGCGTGGAGGACGGACTCGGAGCGCTCGTGATCTCGCCCACGCGCGAGCTGGCG
CTGCAGATCTTCGAGGTGCTGCGCAACGTCGGCAAGGCGCACGCGTTCTCTGCCGGTCTGGTCATTGGCGGCAAGAACTTCCGTGAGGAGCAGATCCGCC
TTATTCGCATGAACCTGCTCATCTGTACGCCCGGCCGACTGCTGCAGCACATGGAGCAGACGCCGGCCTTCGACGCCAGCAACCTGCAGGTGCTGGTGCT
GGACGAAGCTGACAGGATTCTGGACCTGGGTTTCCAGAAGCAGTTGACGAGCATCCTGGAGCACCTGCCGCCCGCTGGAGAGCGCCAGACGATGCTGTTC
TCGGCCACGCAGACCAAGTCCGTGAAGGATCTGGCCGCGCTCAGTCTGCGCGAGCCCGAGTACGTGGCTGTCCACGAGCACTCGGCGAACGCGACGCCCA
AGGGACTATCGCAGAGCTACGTGGTGACGCCGCTGGAGCGGAAGCTGGACGTGCTGCTGTCATTCATCAAGTCGCACCTGAAGCAGAAGACGATCGTGTT
TTTGTCCACGTGCCGTCAAGTGCGCTTCGTGCACAGCGTCTTCTGTAAGCTGCAGCCGGGTATCCCGCTTTGCGCGCTGCACGGCAAGTACAAGCAGGGT
AAGCGTGTCGAGGTGTACTACGAGTTCCTGAACAAACCCGCCGCGGTCCTGTTCGCTACGGATATTGCGGCGCGTGGTCTGGATTTCCCTCAGGTCGACT
GGGTGTTGCAGCTGGACTGCCCCGAAGACTCGGCTAACTACATTCACCGTGTGGGTCGTACGGCTCGTTACAACAAGCAGGGTAAGGCCCTCATGTGCCT
TGTCCCGTCGGAGGTGGATGGTATGATGAAGCGTCTCGAGGATGCCAAGGTGCCGATCCGCGAGACGAAGCTGAACCCCGCCAAGACTACGAGCTGCCGC
CAGAAGGTGGCGTCCGTCGTGGCTAGCGACAAGGAGATCAAGTCGCTGGCACAGAAGGCTTTCATGTCGTACGTGCGTTCGGTGTACCTGCAGCCGGATC
GCGAGGTGTTCGACGCTACCGCTCTGCCTCTGGATGCGTACGCCGAATCTCTTGGACTCCCTGGTGCCCCGCGCATGCCCTTCTTGTCAAAGATGAAGGC
TGAGCACGAGAATGGAGGCAACGAGGCTCTGCGTGAGGAGCTTCGTGGCAAGAAGAACGTCAACCGCAAGCTGCAGCAGCTCAAGGAGAAGATCAAGGCT
GAGAAGGAGCGCAAGCGTCTGGCGAGACAGTTGGCTGCGTTGAACCCCAAGGAGCAGGAGGAGGCGAAGAAGAAGCTGGAGAAGAAGCAGGAGGAGGAAT
CCGAAGAGGAGGAAGAGGAGGAGGAAGACTCGCTCATGGTTGTCAAGCGTGTGCACAACTGGGACGAAGACGAGGAGCTCGACCTGGACGCGCTTGGCCC
CAGCAAGAAGAAGCAAAAGAAGCTGCGCGTGGACCGCGAGGCCATCAACGCTTCCAAGGTCGTGTTCGACGAGGAGGGCAACAGTACCAAGATGGCGGAC
CGCCTCGCGGCTCGCAACACCGGCGACAGCGAGTTCGCCGACGTGGAGAAGCACGCCAAGAGCTACACGGAGCAGGTGGCCGCTCGTCTCGCCGCCAAGG
ACGAGGAGGACCGTCGTCTCGAGAAGGAGCGTGTGCGTGCCAAGCACCACAAGAAGCGCATGAAGATCAAGGGCGAGCGCGACGACGAAAGCGACGACGA
AGGCGCGCGCCTTGTGGTCGGCTCCGACGACGACGAGGACATGAGCGGCAGTGGCAGCGAGAGCGGCAGCGACGACGAGGAGGAGGAGGCCAGCAGCAGC
GAAGACGAAGAGGACGACGTGAGTGACAAGAAGAGGAAGGTCGATCGCAACGCCGTGGCCAGCCAGGAAGAGATGGCCTTGCGCATGCTGCAGCGCCGGT
AGATTCCCCACCTACAGTAGATACTCGAACCTTTTGATCATACACCACCACCATAGATGCCTATCATCAATCTGTCCACAATAGAGCCCGTCCACAAAGG
TGGGACCTTCGCTTTTCTTTTGCTGCTTGGTCGCACACGGTACCGCCCAGTCGAAGCGTCGAAGCAACCTTCCATTCTCCCTTCCTTCCTTGCGGCCATG
GGCGACGACGCCACTTCTTCTTCTTCTGCCCCGCACCCGCTGCGTCGGCTCCCCAGCGGCATGCGCGTGCCCGCCGCCAATGGCTCGCCAACGTCTGCGT
CCTCCGTTCGTCCGCGTCGTCGGGTGCGCGCGCTGGCGATGATCCTGGACGACGTGCTGTACGACCACTCGGGGCTGCTGTCCCACCTGGCCATCGACCG
CGGCGTGGCGCAGCTGCTGGCGGAGGGCGCGTTCCCGACCAACGCCGCGGCGTTCGAGGCGCTGCAGACCTTCCGCAACGCCTACGGACTCCGCAAGCGC
TTCCCTCGCTTCGTCGACAGCCTCGTGGGGGGTCCTCAAGCCAAGCTCTCGCCCGCGCAAGCGCAGCGCGTCATCGCCGCCTACTACGAGAGCAATGTGC
CCGAGGCGCGAGGCATCACGCCCTTCCCGGGCGTACGCAAGACGCTGCTCGAGCTGCAGGACGGTGGGGCCTGTCGTCTGGCGCTGCTGCTGATTGGCAA
GCCGGAGGTGCAGCGCGAACGCCTGAAAGCTCTGGGCGTGGACGACCTGTTCGACCAGGTCGTGTACGTGAGTCCCAACCCGAGCCTGGCTCAGGTAACG
AGTGCCATGAAGCAGCTCGCAAGGCAGCTGGAGGTGCCGGCGTCCGCCGTCACGTTCGTGGGACGCAAGGCCTTCTACGAGATCAAGGCGGCAAACACTG
TCGGGATGCTCACTGTCCGAGTGGTAAGGTGCTTTCTGAGACGGAGGGGGTTGCTTTGGGAAGGGCTTGTTTGACATGTTTTGGATACTTTTGTTTGTTT
GTGTGCTTGTAGCTGTTCGGTAAATACACGAGTGTGATGCCCACGGACGAGATGGAGCAACCGGACTTCCAAGTAAGGAGGCTTTGTCTAGTGTGCTTAG
TGGTGGGGTTCTACTTACGTGGAGGCTCATTGTGCGGTGTTTGTTTTTTGGTGATCATAGATTGAATCGATTGAGCAGCTCGTACCAATTGTAAAGTTGG
CAGACCAGCAGATGCTGCAGCCCAAAATCGTGGCTATCGGTGGTGGCACGGGTTTGGCTGTGCTGCTAAAGGAACTGCGTCACTACCCGGCCGATCTTAC
AGCAGTAGTAACAGGTACACGCTTTAACTGTTGCAATTATCTCTTTGAGCTTATGTGGATGACTTGTGTTGTATACTGCTCCTAGTGTTCGACTCGGGTC
GCCACTCAGGTGCTCTTCGCAAGTACTTGGGTATCTTGCCGCCCGGTGACATTCGCAACTGCCTTGTCGCTCTTTCCGACTCCGGTTGGTAGTCTGTTCT
TCCGTTGACCTTACCGCACGCGCACAGCACTGACGTTTATCCTTTCTTTACATGCTCGTAGATGAACTTTTGAGTAAGTTGATGAACTACCGCTTCCGCG
AAAACTTCATGGAGGGCTGTAGCCTGGGCAACTTGTTGCTGGCAGCGCTGACCGACCTGCAAGGTGGCTTCGATCGCGCCATCTCGTCGATCTCTGATAT
TCTCAACATTCACGGTTCCGTGCTACCAGCCACACTTGAAAGTACCGAGCTGTGTGCTGAGCTCACGGACGGCTCCACTGTCATCTCGGAGGTCAACGTG
CGTAATCCCTTTGTGCCGGACGAAGAGGATGAACCCCGGTCAGGCACCGAATCCTCATCGAGTAGTTCGAGTGGATCGCCCCCTGCAACGCCCCCGAAGC
CTGAGAAGGAGAGGATCAAGAAGGCGCCGATCAAGCGCGTGTACCTCGAAAACCCCGACGTTGAAGCCTTCCAGCCTGCAGTGCGTGCCATCGAGGAGGC
TGATATCATCATCCTCAGTCCCGGTGGCTTCTACACGTCGATCATCGCTACACTGTTGGTCCCGGGTATTCGCGATGCCATCGCACGCAGCGCTGGCGCT
ACCGTTTACGTGAGCAATGTGACGACGCAGAGTGGCCAGACCGACGACTACACACTCGAGAAAACGCTGGAGGTGCTGTCCACGTATCTAGGCGCGAACG
CTATCGACTACGTGATCGCCAACAACACCCACCCGCCGGAAGATGTTCTAGCGCCGTACGTGGAGCGTGGTGAGGAACTCTTGCTACCTACTCCTGAGAT
GGTGGCTAGCAAGCACCCCGTCTTGCTTCAGGGCCAGACGTTCCAAGAAGACCTCGTCGCTGGTCACGTAGCGCGTGAGTGGAAGAAGGCTCCCATGCTC
AAGCACAGCGGCCGTCGAGTTGCTGCTATTCTCTACACCATCATTGACCAAGAAATGGCGCGCCACCGTCAGCACCAGCAAACTCACTCGGCCTCCAGTG
CAGTTGTACCGAGTACAACGATTCCGAAACGTTTGTGGAGATCGACCTTCACCGCACCGGCGACAGTGCTGGGTCTACTTGCAGCCACAACGTTGTTGGC
ATCCGTTCTTCGTCGGTAAGTTTACCAACGCAGGAGCATTCGCATCGGTAGTAAATATCAAGTTTGGTTTAGCTCAGGAACGCGAACGTCACGTACATAT
AAGTTCTACACTTGCATCCTCCTGAGGGTTTAACACACTACGGTCCATTTATTTTCACACATAGTTTTGACTCGCCGCCATGCCACGTTCAAGTCCGCGG
CTGCGATGACACAGAGGAAGACGAGGAAGTAGAGGGCGTAGACGCGGATTTCCTTGGAGGTGCCAGGGATGAACGGGGAGGTACAGACGCGCCGTTCGAC
TGGCCTGGTTGCTCCTCGAAGCCGTGATGTGTGACCATAAACTCCGAGAAGGCCTGCGTGGCGATGAACAGCGTGCGGAACTCACGCATATCGGGTGCGG
ACGCCGCAAGATAGCTAGCCTCGTCGAAGAAGACCGTGCGCTTGCGCGCAAACTCGTCTGTCCAGACGTAGCGGTGGTAGCCGAAGTCGCCGATGAGCTT
GTTGACAGCCCTGAGGAAGAGTCCGCGCACTGCCACCTCCGGAAACACAAGCGGCTTGCTTGGGAAGTGGTGTGCAAACACGTGATCACTACGACTCACG
TTAGGCTTGAGGCATTCGTACAGTGCATCACGTAATGCAAACCTCACGCTATCCGGAAGCGCACAGGGCACTTCTCCACGTAAAACAGCTCCCTTGTCCA
AGTCCACAACCAGTAGTTCCTCTCCAGCACCCGCAAACAAATCATCGCCACCTTCTTCAACCACTTGGCGTTGGGCTTCTTCAAGAGCTTGCTTCTCAGC
GCCGAAGATGAAAGGCGTGGGGCACTCGAGAAATTGCAGCATTCGTCGAGGAAGAACTGGCAGATACACGTGTGGCCAGAACAAAGGGTGCATCAGCGCT
CGCAAGGACTCGCCGACCTTCATCAGCACCGAGAGATACGATGATACCAGCAGAATGCGATTTTCCAGCAGTGCTGCCGTGAAGACGAGAAGCACAGTAG
ATACGTCCAGCGTGTCGAATAGTAGTCTTACAGAGTGGTCAAGACGCGGAAGAGCTGCGAGAAGCGAGCCCGATGTCGCCTTAGGGGTTAAACCCGAGGC
TTCAAGAAGAGATGATTCCGGTAGCGGTGACGGCTGGTGATATTGCGAGATGTGCTCCTTGGCAACGGCACGAGTCAACTTGGCAAGAACTTTCTTGTCC
AGCTGGAAGCCATGTCCACCGTTATGAAGCACTCCCTTGCCGTCTCCATTGGCGGCGGCGGCAGCAGCGATGGTCTCAAGCTCCAGAATGAATTCATACG
CCTCAGCGAGGCGCTCTCGCAGCAGATCCACCATCGGAAACTTCGACAGCACGCACACGCCATAAGGCACCCATCGGCACCCCGCAGCAGATTCTATTCG
TGATGACTCGAGCGCCCGACGCGATAAGGGGGGTGCCGGCTTATAAAATACTAAACACGCCGCGAACAACTCGGCAACCGACGCGCCAGCACTGCTATCG
CCCATTCGAAAGTTGAAAGCCAAAGGTGCTGGACAGGATGGTGCTGTGAGCACTACATGCCTCGGATCCGCACACCAGGGAACCAGGAAATTCTCAACGG
ATTTGTCCACGGGGTGTGGGGCCGGGTCATGCGGCAATGGGTGCTGCACTACCTGCAGTTCAATCGAGTCTTCGAACACTGTACCACCATTCTCGTCAGC
ACCATTTTCGGCGTCTTCCGCACTCAGGGGCACTGCTACAGCTTCAAAAGTGAGTACACCAGATACGGCTTCAAAGCTTCGCGCAGTCCGGAGCGAGTCA
AGAGTCTTCTTTTTCGGTGTTGTGGTTTCAGCATCGCGCGAACTAGACGACGAGGATGACGATGTGCTAGATGACGAAGAACTTGAACTACCTCCCGTCC
AGTGATGCGCACGAAGCCCATAACTCAAAAGCAGCGCTGAGAGACGCATGGAGTCGTCAATCGAGTCCTTCTCGTCCTCAGGCGAAAGCTTCGGGTACAG
CGCAAACTCAGCGTATGCACGACTTGTGAGGAAGCGATGGTATAGCTCCAGATGGATGAGGCTGAACTTGGTCAAAATCGCGTCTTGTTCCGCTTGGAGG
CGGGCACATGATGTTACCAGGGTGCGTGACAGGGTCTGCATCTCGGTATCCCCAGCGTAGTATTTCTGAGAGATATACTTGAGCAACCTTCTGCAGCGAT
ACGCAGCTTGCTCTATTCGCTCACGACGTTGGTTGCTGCTTGTGCTGCTAGGCGCCGCAGCACTTCGAGAGCTGCCGCTGGACTTGAGCAGGGCCATATA
AATGCGGAACGCTGGCTTGAACTCGTACTCGACGTCCAGCCACAGCGCGATTTCCCGATGATAGTTGTGCGGGAACAGGAAGATCCAGAAAAAGTTGGCG
AAGCGATGATTCATCAGGATGTCTTCCAAGCAAATGACTTCACGCTCCACGGTCTTTTGCATTTCAGTGTAAAGATCGGTCTTGCGAAACTCCGGAAACT
TGAACATGAGCACGCGTTTCACCTTCACAGCGACATCGTCAAACGTTCGTAGTGCATCTTCACCACCCGCCGCCAGATCGTGCTTGATGCTGCGTAGCTT
GTTTGAGTCTACGATAGGAGGTTCGTCACTTCCACCCTCATCATCAGCGGTGCCATTGATTGGGAACTGCGCGTTCTTGGCAAGGTATTTCATCGCAATT
TTAACGCCGTACGTGCGCAGCATTAGCACGTCGTCCTTCGCAAAAGGCTTCTTCTGGTAGTTAGCGCGCAATGTGCACCAAAACTGGCGATACTCCTCAA
ACGAGCAGAGGAAAAATAGTTTACTCTGGTCTGCAGGATCGGGAAGCCAGGCCGCGTAGTACCGCATCATGCGCGGGTTGCTGATAACTTCCTCTATGGA
TATAAGCGTCGTCGGGTCTGGAGTCGGTTGATGCGCTGGGAAGGGGAACTGCTGTTGCTGCTGCAAAACCTCGTCCTTGAACGCGCGCTGCATCACTTTG
CCGAAATTATGCTGGTACTGATCGTGCATCCATCGATTCCACTTCTGAAACTTGGCGCCACCATTTGATGCAGGTCCGAACGATGGCAACGGAAGCAAAG
AGTGGTGATGATTCGATGAAGACGGCGCGCCCGACATCGCGCCAAACCCACTACCGCTGCTCATTTGCGATAGAATTTGCTTCTGTTTGTTCGCCCAAAT
TTCTGCTGACGTTGGTGTAGCTGATGACATGGAGCCGCTACTGCTGTCACCAGCAACAGAAGCCCCATTCTTATTGCCTGATACTGTCGAGTATAGGAAG
CTCCGTGCCTTGAGCTTAACATGTTGCGCCCACCTGGACTTGGCATTCTCTAGCTTGACATCCTCCTCCTCCTCCTTTATACTAGTGACTTCATAACTAT
TGGCATCTTCATCCGACCCACTCAGCACCTCCGTCAGCTCCCGCGCACTCAATTCCCGTTCCGGTTCGAACAAATCCGTCTCGTACAGCATCTGCTCCGA
TATCGTACTCCTCCGAAAGGTGCTGCGACTCGAAAACGAAAACGCCAAGCTGTCTCTCGAGCGCCGTGACATGGCCAACGAGTCTCGCTCCGACCCCGCA
ATATTCAAGTTCCCATTCACAGCAGCAGACCGCCGTTGATGCGGCAATAAAAAATCATCCTTGTCTGTATACAACGACGAGCTCAGCGCACTCGCCATAC
TCTCCCGGATCACCTCCTCCGCCGATATCGTACTATCCGGGGGCAGTGGCGGACTCGAATCCAATGAGGCTGCCAGTAAAAAAAACAAAATAATAAAACA
AAAACAAACCTGAATCAGTCTCCCTACTCCGACCGTGCACACACCCTTGCCAACGCAACGCACACGCTCTTCTGTATCTCTCGCTGCCGCTGCTTCTTCT
CCCAGCAGTCGAGTCCCCCAGCATGTTCCGGGTCAATCTCCCACCGTCGTCCACGCCGTCTTCCTCGTCGAAGCTCGCGGCCCGCGCACTGGCAGCTTGC
GATTGTGCGTCCACCGACTGCCTGGCCGCGTCGATGTCCATCATCAAGAAGCTGGCGTGGCTGCGCAGCGCCGAGGACGACACGGGCACGCCCGCGCCCG
CGCGGAAGCTCGAGCCGGCGCTGTTCAAGCGGAAGGAGGAGCCCACGCCGCCGCTGTTGCTGAACGGGTTGAAGCCCGAGCGGCTGAGGCGCCGCCCCGC
GCCCACCACGTGGTCCGCCGACGCGCTGCGCCTGAGCTCCATGACGTCGCTGGGCAGCAGCGTGCGCTCTCCGTTGCTGATGCTGGCGCCGGCAGCAGTG
GTGACGTTGCTGCTCCTGCTCTTGGAGCTGACGCTGTCGGGGCTGGGCTCGACGCTGGACGGCGTGTTGAGGATGGCGCCGCTGCTGCGGCTGCGACGCC
GAGGCCGCGTGCGGACCTGCGCGCGCTCGAAGTCGTCGCTCATGGCGCCAAGGAGCGGAGCGAGGGGCGGAGCTGCACTCGCCCGGCCGGCTTGGCTTTG
GGATGTGTCTTCCTGCAACGAGCTCGCACCTAAGCGGAAGCCGGTGTGACGTTATGTTTGTATGCTGTGTTGGTGTGGCGTACACCAATTGAGCCATTTT
GTTTGTGTGATGTTCTTTTGGAATCAGTTTGAGATCTCTCGGGTTGAGCAGCTCCTTCGTCTTGCCTGGGTGTGTATTGACGCGTAAGGATGAGCGAGCG
CCGAGTGAACGCCGCGCAGGACGCGGTCATCAAAGTGCTGGTGCTGGGCGACGCCGCCACGGGCAAGACGAGCATCATCAAGCGGTGCGTTGTGTGGTTG
GTCAGCTTCAATCTCAGAGAGGGGGAGGGAGGCTGACGCTGCTGCTGAGCTGCTGTACACGTACATACTAGGTACGTGCACGACGCCTTCTCGGAGCACC
ACCGCACGACGATCGGCGTGGACTTCGCGCTCAAGGCGGTGACGGTGAACGGCACGACGGTGCGGCTGCAGCTCTGGGACATCGCCGGCCAGGAGCACTT
CCGGGCGCTCAACCGAGTCTACTACAAGGACGCGCTGGGAGCGTTGCTGGTTTACGATATGTCCCGTCCGGAGACTTTCGACAGCATCCTGAAGGTGGGG
GCAGTTGAATCGGAGGGTGTGAATGTGATAATAAGCTCTGACTTGTCGTTGGACACATTGTGATTGCAGTGGAAGAAGGAGATCGACTCCAAGGTGGAAC
TGCCGAACGGCAAGCCGCTGCCCGTCATTCTCTGCGGCAACAAGGTGCGTCTGTGCTACTTTTGTGGTTGAGATGAAATATATTGGTTATACTAAGCAGG
TAATGTTTTGTTTTGCTACAGTGCGACCTGAAGGAGGAGGTGGATCGGGGCTTCCTGGACGAGTTTTGCAAGACCAACAACTTTACGGGCTGGTTCGACA
CATCCGCCAAGGAGAACATCCACATCGATGATGCTGCTAAGGCGCTGGTAACAGGCATCCTGGAGCACCAGGACATTTTCGAGCGAAAGTCGGAGGCGAA
GAAGCGCAACGACACTTTCCGCCCCACGAGTGCTGCCAACGGAGGCAACGCAAACCAGTCCAGCTGGTGCTGCAACAGCTTCTAATCTTCCGTCCGAATA
GCTGCAACTCAAGTGATTTCCCCATGGCGCAACAAAAAACCATGTTGTCAGGTCATGTTATTTCCCCATGGCGCAACAAAATACCATGTTGTCAGGTCAT
GTTGGTGCATATCAATGCATTGTATGGGGACAGCGTTAAAATTTGACTCGATAAGTTCCCACAACCATTTCGTGGCCGCTTGCTTGCTGTATTTGCTGCA
ATAGCCTAGCACTTTGACGGGTCTTTTCTCTATGGTACTGATACTGCATTTACTAGTCGAGCGAGCCGAGAAGGCGTCGCTTCTTCGAGCTGCTAGTTGA
TCCTTCGTTGCGCCGGACCTTGATGAAATGCACCTGTAGCCGACGACTGCCAGAGGTAGACATCCCTCGATGCTCGAAATTTTTGCGCACCTTTCGAAGA
TCATGCCGCGCGGCGTTCAGTTTGTCCACTAGTTCTCGTTTGTTTTCTTCTACCTGCTCTAGCTCGTCCTCCAGCTGAATCATCTCCTGCTCCCTCTCAT
CAGGGTGGTTTGTGAACGAAGCCGTGATATCGTTAATGATCTTCTGCACTTTCGCCTCAGCTTCCGGTACTTCTGCCTCCATGAAATCGACCGACCGAAT
AAGTTGACGCTCTTCCACTCGTAAGCAGTACTCACAGGAGTCACTCTTGTCGCGGGCTTTGCATTGGGATAAATGCGCGAAATGATGCTCCACTGCTGTG
CACATTGGTTGAGTGCACACTTGTAGATCCAAGTGGTGTTGCAAGTGTACCAGGATCGACTTGCAGTTCAGCAGACACCGCTGAGCTTTCGATGGTGCAC
AAAAAGATGCATCCACAATCGCATAGCCCAGCTCCATTACACCGTCGAATTCCCGCTGCGCCACCTCCTTGCCATCTCCATTTTCAGCTTTAGCCAGTAG
TAATTGATTGATAAAATCCGCGTTGAAGTTTGCGTTGCCTGGAATGCTATCACCCAGCGTGTCCTGAGATTCCTTGGTATCTGCATCATCATCTGCATAT
CAATCAATGCAAGTACCAGTAAGTTACACGAGTTAGAGAATTGCACCATCGCAGAAAACAACCCTTTAGAAGATGCGTACCTTGAGCATTCTCCTCGTCT
TCACCACTTCCAGTCATCGACACATCATTGCTGTCATTTGTTGATGATTCGGCTGCGGATGCGCCAGCCGTGGCATCTTCGCTTATTTCAGCAGCCTCTG
GTTCTCGTTTGATAACGACGGCATCACTGAAGTGCCACTGATACCTTGAGAAATTAAACACGGGAGCACTGCTTTCGCTGGCTAGCTCATTAAGCCGGTC
CGTTTCCGCTCGAAGAAGCTGCTTACGTTGGGTCCACGTGTTAATGCTTTGCAAGCAGAAATTGCGATTCGCTTCACTTTGTGCGCTTCGAAGTGCGCGA
CGCTGGTCACTGATCAAGTGATCTAGAGCGGCTACGACGCCAAGACTTCGCCGTTGCCGAATTCGAATGCAAAACGGACACACAAACTTTTTGCCATCGA
TGCTAGGAGCCGTGTCCTTCTTCAAGCACGCGCGACGATGCCTGTACACTATCAATATCTCGGAGCACTTTGGATCTCCACACATCTCGTCCCGCTTACA
GTGCTCGTAGTGCAGGAGAACAGAACGACACGTGTCCTCCTCGCACTTTCCAATACGTGCACATATAAGCGCGTCCTCGATCACGAGAGCCGATTCGATT
CGCGTTGCCAGCATTTCCATTAGCACCTGGTCGGTCGTCGGGAACCAGCGCAGCAGCTTGTCAAGATCGACAAGCTTTGACTGAGCAGTCGGTTGTTTGC
TGGGTGTAGTAGCTGCAGAAGGTGAGGTTGCCGTAGTGGATTCTGAAGCTGGCGTGGGCGTAGTTGACGATTTCAAAGTAGCATCAGAAGATGGCGCAGA
TGGAGGTGCTGGAGTTGAAGTGGCAGCCGACGGAGTGGGTGGGTCTTCCTTCCGCTCTTGGTCCCCATTCGTGTTCACTTGCTCGCCCGTCTTCGGTTCT
GCACTCTTTGCAGTCGGCATTGATGCTACTGCTGAGTTTCCAGTCACTGATTCTTCCGCAGCAGGAGCTTCTTGTGCCTTCTCCTCCAATTCGCCGTCCT
GTTCAACGCTAGCGTTGTCTCCGTCCTCTCCGCTGTCGACCGACTCACCCACAGTTTCAAACTCGAACTCTTCTTCCACCGACTCGTTCTCCTTCTCTCC
ATCCTCTTGCTTCGTCTTTGCCGGCGCCCCTGCATCTTCTTCCGCCCCCGCTACAGGATTCACCTTGTCCATCGCCTTTTCCTCTTCTGGAGCTGCAGGC
TTCGCATCCGCCGCATCACTAGCTGGAACTGAACGTGCTTCGACTCCGTTAGTGGATGGATCTGTAGCTGGTTTTGCCTCCGCTTCCACGCTGCCGTTGC
TTGCGTCAATCACTCGTGGTGAGCCCCACGCGAGATACGAACGGGTCTCTCCGTAGCTGCTCGTGAGCTGGTGGCTGCGCGCGAAGCCGCGCGAGTGCCA
CAGTATGGAGCAGCTGGAGCAGAGCCGCTTCTCCGCGCGGGGGTCGCACGTCGAGCACTTGTACAGCCAGCGCGTCACGCCGCACCAGCTGCACAAGTTG
TCCATGGCCGCGCGCTTTGCCTGATGTGAATTTTGCGTTTGACAGGTTCAATCCGCGACAAAAATCGCGAAACATGATGGTGTGGCGCACACCAAAAACG
AGCAGCCAGAAAAACGCGACGAACCCGCAACATGGGCCGGAGAAGCTTCTTCTTGGCCGCCCTGTATGAGCCTGGAGCGGCTAGAAGACATGAAAGGGTA
GCCCAGAAGTAGCTTGAAGTGTAGCAGATGGAAGATAGCATGGAGATTGGTTCAATTACACATGAACTAGGGAGGAAAACCACAGATAGTCGGGCATGTG
ATCAAGATGAGTCAGAGCTCATGAAGACCACGCGTCGCACCGAAGAAGCACGCTTGCTTTGACTGCTAGGAGTCCTATCCTAGGACTGCGCTCCTGCATC
GGATAAACACTGAGAAGGTGGTGACAAGACCAAGCAGCAAAAGATCCAACCCCACGTAGAACGCCCTGACTCAGCACGAAAAACAAACCAAGCTGAGATT
ATCGCTAGCTTGCACTTTCCTGCTGCTTACCGACTGTCCTCGCTCTCCATCTCACCCGGCGTACACTCAGCAGCCGCAGATCCCCCCGTCGGAAAAGGAC
GGAGTGGAAAACCGGCTGCGGCCGCGCGGCCTGGGACGAAGATCTCCTACTCCTAGCGTGCTCTAAGTGGCGTACTTGGCGGTCCATTCGCGGGCAGTGG
CGTCGTGGCGCGCGCGGTCTGTTCTATAAATTTGCGCGATCTCGGGCACCAGCGGGTCGTCCGGGTTGGCGTCCGTGAGCAGCGAGCAGATCGACAGCAG
CACCTTCGAGATGGTCAGCGCGGGGCTCCACTGGTCCTTCAGGATGTCCAGGCAGATGCCGCCGTTGGCGTTGATGTTGCAGTGGTAGATGCGCGTCGTG
AAGTTCACCTTGGGCGGCTTGAACGGGTAGTCGGCCGGGAAGTAGATGTTCAGGAAGTACACGCCGCCGGCGTACGGGCTGTCCTCGGGGCCCATGATGG
TCGCCTGCCAGTGGAACAGGTCGTCGCCCACGGGTCCGGCGCTGCAGTTGGCGGGCGGGTCGCGGCCCAGGTCCTGCAGCTCCTTGTTGATCCGCTTAAG
AGCCATCTTGTGGTGTCCCCCCTCGTGTTGCTTCGACTCCGCTCTGCTGCTTCCTGCTACGAAAGGAAAATGACAGCAAAGCTGCGGGGGGCCCAAAGGG
GGGAGAAAGCTCGCGCGATCCCCCTGAACGCGCAACCGCCCCATTGTGCGGCTGTATGGCGGTTGCCCGAAAAGGGCCTTCTGGAAGTTTTTCTCCGTTT
TGCCAAGAACGGACCTGGTGGGTCGAAAATCTCGTACTTAGCGGGGAGAGGCCTCCACACCTGATTCACCGCGCCGGATTGGCCAAAACGAGCGGCGAAA
GGGCAGACCATTGGCTGAAAATAGATTCCGCAAGTCTCCCTTGTCGGCTCCGCAGATAGCTACAGGTTGTTGCCTTGGCTTGCTCTCTTGGGTGCATGCT
CCCAAGATGGACCAGCTCACGGCGAGAGCAGGCCGGATTCAGCATGTGCCTGCTGCTTGCTTATCATTGCTGGTGGGCTAGTCGCATCGACCCGACGCGC
CATTCCGTGCTGCGCTGCTGACTGAATGCAGACGGTATTTAGGATTACAGGTAGCAGACGACGCACTCGACGTCCGCCGCCGTCCACATCAATCAACACC
TTCAACTCGGCGGCATGGCGCGCTGCTGGCACTTGGCTGTTCATCGTCGCCGACGACGAGCAATTGCCACCGTTGCCTCGCTCATACGTTGCCGCAACGC
AGCAAGGTACATGCATCTTGCGGCGGACGATTGTACGACGTCAGCGGGGACAGCCTTGCTGGCGTCGCCTGCTTGGTCGTCAGACGACCACGATCATCCG
CCAGGCCACGGCGCTTTTGGGTTGGAGGACTGATGAGCCCGTGCTGGACTTGAACTCTTGACACCTGTAAAATGCAGTCGCGCTTCAACATGGTCGCGTT
GTGGTTGGCCAAGAGGGCAATCACCACCTGGACGTACAGTACCCAGCTCCCATGCCGAAGAGGAAGACCAAGCAGCCGCAGCAAGCGTTGAGGGCTCCTT
CTCAGGGTAATCGATGACAGAGAGCACCGACATCCCTATCATGCAACAGTGTTGCAGCAACACAGCGTCGACTGTCACGGGTTTACGCCGCGCAAATCTC
AGCGCCGCGAGGCAACCCCCACCGCCCGCGCTCCCACGAGCTGCTTTTTTCACGGTCCCCCCATGCAAGCCGCAGGCAAATTCACGACTTTGCTCGACGA
TGTCGTCGAAGCGTAAGTAATAATCAGCTCACGCGGGTTTCTTGCACCTCCTTATATGAATAGTAATGCTGGTCATTTGTAAAGACACGTAGATACAAAT
TTAGTTCCATGCATCTGTTGTGTACGATGTGCACACTAGATCCCTCAATATTACATGTTTTCTGTATTCATTCTCGCAGGTGCGGCACCGCTTAATGCTT
TGCATGTGAAAACTGGCTGGATTGCGGTCCAGCGGGCGTCACTCGCGCTCTTGCCTCCGACGCCCCGTAGCGCTCGGCTCACCTACCTCCAGCTCCAGCT
TCCACCCCACCTACCTCCCAGCCAGCATGGGCGACCGGTACCGCAGCGCGCAGTCGCCGCGCGACAGCAGCGGCGGCGTCTCGGACGAGCGCTTCGGCAA
GCTCGTGTCGGAGACCAGCAAGGGCATCTCGAGCTTCAACCAGCTCACGCGCAGCATCGCGCAGAAGATGTCGCTCTTCGGCACGCCGCAGGACTCGCGC
GCCAACCACACGCAGATCACGGAGCTCACGGAGAAGGGCAACAAGCTCGTGGCCAAGATCAACCGCCGCCTGCAGGAGCTCAACCGCGGCACCAAGGGCC
CGAGCGGCCGCGCGCGCCGCACGCAGATCAACAAACTCTCGGCCGACTTTAAGAACCAGGTGCGCGTGTTCGAGGAGACATGCGAGCGGCTGGTGGAGTC
GGAGCGTCAGTCGGTCGAGTTCATCCGCCGCTCCTCGCAGAGTTTCAAGGGCGGCGACGGCCGCCAGAACCGTGGAGGCGCCGAGTTCACCAACTACAGC
GAAGACCAGATCTACGCGCAGGCCAACGTGGTCATCTACGATGAGGACGGTGCGTTGCGAGTTGTTTCATCCTTGTTGCAGGTAGTATTGAGGTCTCACT
CGATTTGTAATGTTGATAATGCAGATCTGCAGCGGAGAGAGGACGACATTATCCAGATCAACCACCAACTGCGCGAGGTGAATGCCGCCTTCCAGGAGAT
CGACGGGCTTGTGCAGGACCAGGGCGAGATGGTGGTAGAGATTGTGGAGAACACCGACACGGCCAAGGACAACGTGGAGAAGGCTCTGGAGCAGGTGAAG
CAGGCTGAGCAGCGCAGGAAGTGCTGCGCCTGTTCAAAGATGAAGCTCATTTGTATCGCCATTTTCGCTCTGCTTATCTTCATCGCCGTCATGGGTATCA
TTTTCGCTGCCAAGTAGACGACTGCTACGGTTGCGAGGATAGTCGTCGTGTTGCCTGTGTGGCTTCGTCTTCTTGTAGGTATGGGCAGCTGTGGAGCAAG
AAAGTCAGGGGCTCCAAGCAGCGGAAGCTGGTTTTATTTCTAAATAATGGGTTGTATAACTTTGTGGGCAAGCTGTTATCTCGTGTTGGGCTCGGCTCGG
CTTGTCTTGCAGCGGGATTCGCTCCCAGCTCGGTGACGCAGAATAGTTGTGGTGTGATATGCACAGGAGGCTAATAGGCATTGGCACTACCGTTCTGGTA
CTTGAACCCTGGCTCCAGTCTCGGTTATCATGTGTGATGCTCGACGTGGCCCAAGGCTGGGCTTTGAACGCGAGCCTCGGAAAATCGAGTCCGCTACCGA
TTTCATGATGTTGCCGACGGATCCGCTGCTGTGTCGTCGTGGACGCGTCGTAACTTCCGCGGCGGGCTCTTCTGTGACATGGTGGCGAGAGAGGAAGCGA
GCCTTCGAGGTTGTCTCCGACGAGGAACTGCCCCCACTTCCTGCCTGCTTCGTGCTAGAACTTCGACCAGTGAAGCGCGTCCTGGAGTCGACAGAGAACA
TGGCTGAGAAGGGAACCACAGTGTCGTGTTCGGACGAGTCGAAACACACCGCGCATACTCGTTCCTTCTCGTTCACTGCTTCCACGAGACCATTAAAGTA
TCGTGCCGATCCGTGAACGCGGGCCATGACGGACTCGCCCACCATGAAGGTTACTGGAGATAACTCAAAGCCCATCGTGTCGATACTGTAATTTGTAAGC
CGCTGGTTATGAGAGAGAGCGCTGACATCATCCAAGCGGGTTATCTTGTCCGGTGGCATTTGCGACTTCTTCTCGCCGTAGTCGAATACCAGTGTATACA
GGCAGTTGAGTGTTGGAGGTGGTATCGTTGCAATGGAATGTATTGTTGGGGACGCCAACGCTTCGACACCAGTGAGTGAACTCGCTGATGGAGTTGATAT
GACCTCATTTGAGGTGGCTGGAAGATCCTGCGATGTCTTCGCGATAATTTTGGCGGAGCAGTATCGACCAAAGCGTGAGCTCCAAGCAAGCACGTAGTCT
CCCACAGCATACACCGGTTGCCGTGATCGATTGAAGCTGTCGTTTGCAGTCAAGGTGGCGGTGGCCTTGGATATTGTGCGCTGGTGCTCCACGCTATCGA
TGATCATTTGAGATGGAAACACTTCGAACGCAATGGTACCGTCTGAAAAGCGCAGGTCACACGCTGATGATGCATGCGTTTTGATAACGATGCAGCTCTC
AACTGCGGCTTTCCGTGGGTGGTCGGCTTTGACTTGGTATCCTTCCTCAAGTATTGGGAAACTGTCTTTAGCTCCACTGGAAGCCTGCATGAGTACAGCG
TTCTTGAGAGACCGCACGTCCTGATCTGCTGGAACACTAGCGCGTTTCCGCTTAAAGATGAGGTTTGGAGGGATCTCATAGCCTGTGGATCCATCTGCAA
AGTCGACAGCCGCTGTTCGGTTCGAGTAGATACCATTCAGAAGTCCCAGCTTCTCTTCTTCAGCGGTACTGTCAAGATCACCATTTCCAGCCGAACATTT
GACATAAATCTGGTCACCGATGTACACTTTGACCTTGTTGTTGCAGATAAGGAACTGGTCTTCAGTGATTGTCACCGCAGCCTTCTTCTTCTCGCGCAAT
GGGCTGATCTTATCGGCTGGCACGTTCACAAGTCGAATGCGGTTTGCAAGTAGAACATGAAAGCGAGACTGACGCTCCCGCTCCAACGTTATTAGTCCAC
GCCCTGAAAAACGGCTTCCTGGGTACAACGAGACGTGAACCTTTTGACCAGCATAAAGCACATGTTGTGAGCGCTCCAAGTCACAAAGCTGTTGCTCCAG
TTCATAGACAGAAGGAAGGAAATCAACTTTGTCCTTGGGCACAACCTGCACCGAGATACTCTGATCATCCTCAGTCACGATGGCGTATCCACGGCCTTCA
ACTAGTTTTGTGACCGAGCCGTATGCCCGTACTCCATCGGGCGCGCGCTCGTAGACAACCCGGATACTGTTGCAATCGCCTCGAGACGGGGGTGGTGCTT
GACCTAAGTTGGTGGCGTTGCATCGAGCCGATTTCATTGTGTCGAGTTTTGCTACCATGAGACGAATACGTTCGGCCATAGCGAGCTCGTCGCTGAGCTT
GGAAGGCTGAACCTTCTTGTTGCCGCGCATGAAGTACTCAGTTATGACCTGCTTGAGACTCTTTGGTGACGGGATGATTTGTTTCATGCTCTTCTGCGTG
ATAGACAGTCGATCGATCTGGGAGATTGATGAAATACTGGATCGACGTCCTGTGCCACGTTGAACCCGCGCAGCTTTGCCCATACCAAACGTCTGGGTCA
TTTGTTGCCATGGTGTCATAGACATATCCTCCTCGCTCGATTCATCTGAGTCACTCACTTGCGTGGAATCATCTTCGTAGCCTACGCCACACTCAAGGCG
CTTCATTGTCAGTGTTTCATCCTCCAGAAGGTTCCTCCAAGCACCATCGTCTGCGCTAGGGGGAACGCTACCACACTGACTGTGACTATACACCACCCCA
CTGTTAGTTCGGGAGTCGTCGAAGCTAATAACCATTTCTTTTGGTGGCGAAACGGAGAAATCCACCATGACGTGTTGGGACGGCAGCAAATCCAGCTCTG
GGGCTGATAATGAGTCCACCGAGTCGCCGTCACTCATTAAATCTAGCTTAGGCAATGACTTTCGTTGCGGTTTCGCGTCTGCCCCTGGTTCGAGACCGCT
GAAGCTCTCGCTGTTTTTCCCACTGTCCGATTCATCTCGCTCTTGAGAGTGCCGTTGCTTTCGCTTTTGTGGACTCAGGGTGTTGTGTTCCCGCAGCATG
ATGTCCTCCCGTCTTACCCGATAGTCCAGAGTTCCGTCGTCGAACACAACCATGAACACCCCAGCCCCCAGATACGTGGCGATGTTACCCGAGTAGAAGT
AAGGGGTTTTCTTGTATCGTCCGAACACGGCTTGTCCGTAGGTCCACTGGCTGTGCAAGGGCACGAATCGCGAGGCGGATGCCTCAGGCGTTGGTGTTGA
ACTCTTGATGCTCCGAATATCTGAAGTTGATTCGTGAAGACTACGCTTCTCATCATGCTGGCTGTTTATCGCAGCTTGGACTTGGGTATCCCATGTGTCG
TTCGTTTCAACTGCCCCGGGGGCTATTGGAACGACTTCTTTCGGTAATCCAGCGGGTAATTCCCTTTTAGCTCCCTCGTCATGCAGTAAAATACGATCAC
TTAGTTGTCGAGCTGGCGATACTGGGATATTCACCTTTGGTGCAATGTTCTGCTTGCTGGTGATCGCTCCGTCGTCGTGGATTTTCAAACGATCGCTGAG
CTGTCGGATGGGGGAAAGAGGGATTCCGGACTTCACTACTACCCCAGGTTTGTTCACGGGCTTTTCGATGGGGCATTCTTCGGAATGGTGAGACGGAGAA
GTTGGTCTACTCCTTCGCGGAGAAACGACGGGTATTTCCTGTGTGCTGGTCGAAATCGCATCATCATGGACTTGAAGGCGTCCGCTGAGCTTGGTAGCAG
ATGATTGTCGACTAGACCCGCTCGCGGCGACTTCAATGTCTTGGGGCTGGAGACGCGCACTGAACCGCTGCGTTGGAGAAGACGGGTTGCTCAACCGGGG
AGGTGGCATCTCGTCTTTGGCAGTCGCCATTCCAGGTTCAATTGCTTCAAAGAGACCGCTAAGTCTTGACGGTGAGGACAGTCTGGGAGATGGCGCCCTC
ACCTTCGGAGAAACATCTCGGATTTCGTTTGGGTCGGACTGTGGCAGATCGTCATGAATCAACCGGTGCCCCGTCGATTTCAAAGCTGACGATGGTCTAT
TCGTCGACGGCGACGTCGCTCTCGAAGGCTCATTCTCGTCATGGGTTCCGAAGCGAGCACTAGGGGGTCGAGACGGTAGCGACCTTGGTACCCTGGAGTC
GGCAGCACTTACACCACGCATCTCAATAATTGGCGAAGGCCTTCTAGGCAACCAAACGACGTCCACTGGTGTGGCGGAGAAACCAAGGAACTGAGACTGA
TGGGGGCCGTTTATAGCAGGTTATTGTTGGCCGACAAAGACCCTCTTGTTTTAGCTGCCAAGCGACAACAAATCGAGCGCATGC