Description :
From Genome Similarity Track
Location :
Scaffold_229:25649- 27116
Sequence
1467 bases(100 bases per row)
AGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTG
TTCTGTATTTAAGCTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATACCAAGTGAACAATGATCCGTTATGGATCTTCTTG
CATGCCAAGCGTCGTCTGCACTGTCGCATGAGCATCTTTAGCGGTCCGCGCCTTGTCCCAGACGGTGAACGTGTCTTCCAAAGGTCGCTGAGTATTCCGC
GAACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCGGCCAGTCCATTATTAATAATAAGGACAGCCTGGATTCAG
TGACATAGGGCCGTATCCGATATTTGTTGAAAACTCGGAGATGACGCCGTCGAGCCCCTTGCACCTTGGCGTCTCCGTACATCACTCGACCGAGGGTTCG
TCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCACTACACCACAACTGCCCCTGTCGCAATGGAA
GCCACGGTACTGGTGCCCGTTGTGACATTTCTTCATTCTTCAATTCACCATCTCGCCACCGTATGTCCAAGCGTCTGAATCGAGTCGTGTCCGACGCGTT
TCAGCGTCTCAATCCTCGTAGACGTCGCGAGCGTGAGCAGCTGGAGGTACGTAAGCCCATCCTTCTCTTGAATCATCGGTACCTTGCTCATCACCTCGCA
TTACTCGACTTGTTTCTCAGGAGGGCAAGACCGAAGGTTCGAACGCCCCTCAGTCTGCTGCACTTCCTGCGGTAGCTCCTGCAGCACTCTCCGTCGTCGC
TGAACCCGCGGAGATGGCTCCTGCTGCTCCTCCTGCCCCAGCTGGTGGTCCACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACG
GAGGCATCGGTCGATCACATGATGACCTCGATAATCCCGTACTTGACTGCAATGGCTCGTCACCAAGTGCAGATCAGCGTTGTGCCTCCTCTCCACGGCG
ATATACACACCCAGCGTCGTCTCGAGACAGCTATTGGTTTCGATGAGGTCCTCGCTGCGATACAACCTGTTCCTGACGCGCTGTCGGCATTACCCCAACG
CGTTGCCGACTTAGAGCGTCAGTTGCGGTTTGCTCAGTCCGAGGCTGCTGCCGCCGTGCGTTCGGTGGCACCCCACATCATGGCTCGTGAGAACGCGGAG
ACGTTCCTCAAGGCTGCAAACGCTGAGATTGAAGCCTTACACCACCAGGTCAAGATTCTCCGCGAGTCGAACGCCAAGAACGACGCCATGCTCGCCACTG
TTCAAGCCACTATGGAACGACACGCAGAAGACTTGAATCGTCTGCACTGCGAGGTCCAAGCTCGGGA