Description :
From Genome Similarity Track
Location :
Scaffold_69:25648- 29952
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_69-snap-gene-0.7Carbohydrate-binding protein

Sequence
4304 bases(100 bases per row)
GAAGTCGATTGCTTAGAACTGGTAGGTTTTCTGTTTTGAGTTTGTCTGTAGTTTGGGAGAAGTATATTAATGCGTACAGTAGAGTTCTGTCTCTTCCAAA
CTCACTGTGGACTCTCGAGCATCCAAGACATCGCGATCAAAAATTTAAGTCGCAACCGCACATCTCACTCTCCTTTACTCGGTCTCACCAAAACGTGAAC
CCTCTACATTGTGCTTCAACGTCAATCAGAGCGATAGTGTTTTTCAAGCGATGAATATATCCTAACAGCGAAACTCTCTATGGACTATGGTCAGCTTTTC
AGATCACGGACTCTAGACTCACTATCTGTCTCACGGTTTTTCATTCAGGTTTGCCTTCTTGCTGCCGAGATCATTCACCAATTTTCTCATTCCAGCTCTT
TGGCATTCCCAACAACCCTATATCTCGCTCAGTGTAGCCATGATCAAGAGTGCTCTTCTCGCTTCGGCCATCTCTATCATCAGTTCCACCACGATGACGC
TCGCCCAGGCGCCGACGATGACCAGCAGCTTCGACTTAATGCAGCGCAACCTCCTCGCTTCAGATGGTAGCGATGCGCAACTGGATCGCTACCATCCTGT
TCTCCCGCAAACCTGCGCGCACTTCGACAATGTCGGAAAGTTCCCGATGTGTCGCAAGCGCATTCTGCTTCATCGTTAAGAAGACCAGTCGCAGCAGCGC
TACGAATCAGAGCCCTGAGACGTCGGGATCGCTTGGCGCCTTCGAAGAAATTGGCTGGTGAAGATTCGCCTGATACTGAGTATTTGATTATTTTGTCTGG
TAGTGAGGAAGACAAAGACATTGTTTTCTTTTCAGTAATGGTGACGACATTGACATTGGTGAGGTTTACTTAGGGTATTTTCCAGGTCTGGTCTTTGATT
TGGTATTGTCAGTCTTTCGCTGTGGTCTGGCCCATTGGTCTAGGTTTCTAATCGAAGAATGAGCACAGGAAGGGGCACAATAAAAAAAACATTCCGTCAC
TATACATTCAGACCGTGCTGCTTGCACAACGATCACATCGACGCAGGACAAACGACGCAATGTCAGAGATTTTAGTGTATTGCAAGTATGCTACATTGTC
TCATGAGCTTTCTCAACACATCAGGTAGTATGGAATCTGGTCATCTCGCGGAAACCTTTCAGAGTTGTAATTGCTAACAGTGTGAATCTATGATGTAATT
AATTAATAAGCAGAGACCTCCTTCCGCCTTCCAGACGATAATAATGGAGCACACAGAGAATTAGTTGCGCAATATGGATATTTCACCACCGCAATCGTTG
AATATGTCTAGTTGTGATCTTACGATATTCCAACACTGTGAATGCATCTGGCGATTGAAAATGAAGCATCGACACTTTCAAACGCTTTCAGTTGTATATT
TGAGACGTCGAGCTTCCGAGCTCAATACATTCCCACATTAGAATACCACCAATTTGCAAGGCGATTCTTCTTCCGAGTTCAGAAGCCTATCGCGTGGTTT
CTGAATGGTTCCAAGTACCGTAAATGACATCCACACGTTGATGTTTGCGTAGATGTCCCATTGATTTCTGTAGAGGTCGATTCATGAAAACAACATGTTG
ATTGACATGATTGGCGATGTGGAATGAAGGGTTTGTTTATCACCATCTTCGGCAGCAGCCGAGCACCTACGCCTCTGACTGCTTCTCTCTTGGTTCGTGA
CCTAAGTGACCCCCCTCCCCTCCTCCACCCCCAGACCCACTTCACCAACCAACCGAGCGGGTTGATGCCGACCTCTACGCGACCATCAACAGCGAAGCAC
TCCTCGGAGAGTCTCAGTTTTTCGAGGTTGTACATATATAGTGAACAAACGAGACGTGACAGACATCATATCTATCAGAATACCTAGCTCGTAAAGCTGA
AGGAGTTCGCTCGCCGTTATGATTTCTTCTCGAATGCAGTACTCCACGGGATAAAATCCAAAAAATGTTATTTACAAATTATAAACCACTATGTTATCCA
AATAAACGTTTTTCTGTTGACTGACCTTCAGTCATCGTCAACCATTGCAACCAACTCCAGGCCATCAAAATGGTCCTCTTAGATAGGCAGATAGACACTA
ATTCTTACTGAAGAAGCACCGCAGCGATACACGAGACCGCGAGCGCCGAAACCGCACCCATGGAGCTGATGACGGCGCTGGACTTGGTGGTGGTGGGCGT
CGGCGCCTTGGTCGTAGCTGCTGGCACTGGCACATTGGCGACCGAGTCCCAGGACTCGGACGAGTCCTCGATTGAGTCGTATGAGTCATCGCTGCCGGCC
TTCGGTGGCGTCGTCTTGGTCGTGGTCGTGCTTGATGGCGCCTTGGTTGTACTCGAGGGCGTGGTGGTCGTGGACGTGGGGCTCGTGGTCTTCGTGGGTG
TCGTGGTGTCCGGAGCTGGAGTAGCTGGGGTAACCGGAGCTGCGGTGGTCGGAGTCGATGGCTTGGCGGTGCCTGGAGCTGAAGTACCCGGAGCTAGAGT
AGCTGAAGCAGGGGTCGTTGGCGCCGTCGTTGGAACACTGCAGGACACCGCCTGACCATCGCACACCTGGTTGTCCTTGGCACACGAGCTGGCCGGGAGG
CTGAGCACACAGAGGTTCCAGCAGCGCTGACCGGCTCCGGATTCGGTACACGTGCACTCGTCCGAACACTGGGTGGCGTCTCCCGCGCCATGGCCCTCGC
GGTTGCACACGACGGCGCAGCCGTAGCCGGACTCAGTCTTGCCAGCCTTGACCTTGCACTCGCGCTTCATGCAGCTGCCCTCGGAGGCCTGCAGGTGGCG
GCCTGGCGCGCAGCCGACGCTCATGACGTCGCTTGAGCTCTGGTGCGTCTCCAGAAGCAGCCGCGTCGTGGCGTTCACGTGCGCGTCGAAGACGACGTTC
TGGTTCGCAAGCATGCGCTGGTAGGCAGGCAGCAGCGTCNNNNNNNNNNCTCGTGCTGTTCACGTGCGCGTCAAACACGACGTTCTGGTTTGTGAGCATG
CGCTGGTAGGCAGGCAGCAGCGTCATCTTGCCGAACCACGTGCGCAGCATGCGACGGTCAGCGTTCTCCGCACTCTCTGGCATCTTCATGCCGTGGAGCA
CGGCCGGCAGCGCGTGACTCGTCTGCAACCAGCGCGAGGCACCCGTGCCCATCATAATCACGACTTCATCCTCATTTAGCACTGGCCGCACGCGCTGGCC
GGCGGTCGTCTGGATCACGAGTCCGGACTTGTCAGCCGCGAGGTTGTGCTCCAGGAGCTTGCGCTCGCTCGACTCCTGCACCTCGAAGAACTTGGGCGCC
GACATGGCGATGAAGAGGCCATGGTCCTCGTGCAGTGGCAGCGAGAAGGCCAGCTCCCGGGACTCTCTGGTGGAAGCAGACGCAGCAGCGGCAGATTCGT
AGGCGTGAAAGTGGTCGAGACGGATGGCTTCGCTCACCAGCTTGCGGGCCGTGATGGCTGTGGCGCCGTCCGAGGCCTTAAAGCTCGTGGCGTCCAGCGT
GCTGCCGAACGTGTTGACTGCGCGCTCGACGAGCTGACTGAACTCCTGGTAGAGCTCCTGATATCCCGGGCACTTGGTCTGCGTGTTGGCCGCCGAGCCG
CCGAGCTCCGAGCCGGCGTTCGTGCTGATCGTGTAACGCTTCGTGCCGTCCTCAAACTGCTTCTGCGAGAGGAAGGACGACGCGTTCTCTAGGTCGTCCG
CAGCCGCGACGGCGCACTCGGCCGCCTTCTGCAGATACGCGGCGCGCACGTTGGCGTAGTTGGGCACGTTGCGCAGTGCCACGATGCCATTGCTCTGGAG
CTCGGCGAGCAGCTGCGTCGGCGTGGCGCCCTGGTCCATGGACGGGTAGTCGAAGGACGGGATCGCGAACGTTGGGAGCTCCTCGTAGGCGCTGGTAGAG
GCGGAGGCAGCGGAGACGACCGAGGTGAGGGCCGCGCCCAGGAGCATTGAGGACACGCTCACCATGGCGAAACTGGTGTTGAGACGGTGGTTGGAAGTGG
CAGATGCTGTAATGAGTCAGTGATGAAAGGTGTTGTTGATTGGCATCATCTGACTCAGTTGGGTTCGCTTTGGAATCAGATCGTTTGAATCAGATGTTGT
ATCTTAACCTGTGAAACTGGATATTTGTCAGTGGGGTATCGAAGTTAATTGGGTAAAACGAGACGCTTTAGCCTGTGATATTTAATATTCTGTAGTCATA
TATAGATTTCGTGACATATAATGTTTAACAGGTGTTGATTAGAGCAGAAAGAAAAATCAGGTCGGTTTTTTATGTTTTTATGTTTTTTAGAGCTCAGACA
GCTT