Description :
From Genome Similarity Track
Location :
Scaffold_144:25648- 27008
Transcript NameFunction/comments
Phyke_g5014hypothetical protein

Sequence
1360 bases(100 bases per row)
GGCAACTCCAATACTCTCGAGTTTTTCTTCGCACGCATCTTTCTTGAGCTCACGAAGCTGCTTTAAAGCATCCGCGGGgctggcagcagcgaccCAACGA
TTTTTCTGGAATAACTCGCTGTACTTAGTGGTAAAGCCAAGCCGATGTAGCCACTCTTGTACTGCCATGCCCTGCAGCTCATCGCTTGGGTCATAAAACT
CGCTTGACATGGCTACCATCTTTTCTATGATGACACTCATGAAGTCTTCTGAGTGGAATGGACTTATCTGCTTGCGCCGCTGAGCATGCAGGAGCTTCCG
AGCTGTTCGGTGGTGCGCATTTTGCCGCCATTTAAGTTGGATGCGTATGGCCATACGAGTTCGTAGTTCCGCGTGGACGAAAGCTCTCCGTACACGAGCC
CGGCAGTTGTAGCCACGAAAAATGCGCTGGATTCCACATGCGGAGGCGTTGAATAGCTGCATCGTAGATTCGAGGATCTTATTAAGCACTGCTTCAATGC
ACTTGTCGGCGGTTTGGTGGGCAAGGTGGGTTCTGATGCGCGCAAGCTCCTCTTGAAAGTGTTTGCGCTGAAGGTGTATACGTATGATGCGCTGGATTAA
GCGCGCAGAGCGCTCACAACGAACAAATTTCCGTCCCATGTGGCCACGCACCAATGACTGGATGCGTGTTGAGGTGTCTTGTTCGAGTTCAAATTGACGG
CGCATGCGCTCTTGCCTATCTTTCACTAGCCGAATGTGCAGATGGCACCGCAGCCTCCCTGGAACCGCTTTGAGCCACcagaactgcagctgctttGCCA
TCGAAATATGGTTGGCGTGATGAACGCGGAAGAACCACTTGATCCGTCGATGTGCCATTTTCTGCCGGCGCATCAACTCGACAAAACTTTGTGCGGCATG
TCTTCGAACATTTCGCTGAATGAGTGCTGCAGCCTTATTGCGTTTCGCGCTCAGGTATGCCAGCCATGCGTGGCGGATAACATGTGCCATGTGCTTGCGC
TTGTAGGCCAGCACACGAGCATCAAACTCGCGCTCCTCGTTCTCCTTTTCACGCAAACACCCTAGCAGTAGGAACGTAGACCACTCGTTGTTGCGCTTGT
ACCAACAGCGCTGGAAGATCAGCGCTGCATGCCACTCTTCGTTTCTATTGATTCGGAGTTCACGTGTCGCACACCTCCCGATAAATCCACGCGCAACACG
CTGTAGCAGCACGATGCTGGACAGCACACGCTCGGTTTCTTTTCGTTGTGCACAGAGTACTAAGCGCCGCAATCGTCGCATGCACACCGAGCGAAAAACC
GATTGAACCAGCAGTGCCGCGTTGCGGAGAGTCAGAAACGCATCGCGACACACACGCATT