Description :
From Genome Similarity Track
Location :
Scaffold_138:25638- 31444
Transcript NameFunction/comments
g18575.t1XP_008904795.1 CMGC/MAPK protein kinase [Phytophthora parasitica INRA-310
g18576.t1RAW27811.1 hypothetical protein PC110_g15792 [Phytophthora cactorum
g18577.t1ETL94329.1 hypothetical protein L917_07695 [Phytophthora parasitica

Sequence
5806 bases(100 bases per row)
TGCACTCGGATTGGTCGAATCTCTGCGCGTTAGCTACTTTTAGAAGTGTCCAGTACGTTTGCGTCTTTTCAGTCGAAATCTTGAATAGTTGCTGCCACTA
TCCCATTCCCTCTGCGCCATGACGCGGCAACCTCCCTCGCGCTCGCCCCTGTCGGCCCCTTCGTCCCTCTCCGCGCGTCTGCATCGAGTGTCGTCCCCTG
TGCCTGCAGGTCCAGGCAGCGGCGGCGGTCTTCGCTCTCAGACGCTGCTGGCGCGACTGTTCCGGCGTAAAGAGCAACAGTCGCCCATGGCGCCGCAACC
GCTCAACGATTCGATCCGCACTCTGTATGGAGAAGAAGAAGAGACCAAGACGCACGTGGACTCACCCATGCGCGCGCTGCTGCGGTCGCTCAGTCTGCAG
CGCAGCAGCAGAAGTGCCGACAGCAAGACGGAGGCGCTCACGCCCCGCTCCGACGCCGCGCAGGTCCTGCTCGAGGGCGTACTCACCGAGCTCCTGCAGC
AGCGCTACTGGCGCTCCAAGCCTTGCTACTTGGTGCTGGAGCAAACACTGGACAGCGGTGCAGGCAGCCAGCTCCGGTTCACGTTGAGACAGTTCCGCTT
CTTGGCCGAGAGCAGGAAGCCCGGACGACTCGTGTCTATCGTCACGCTGTCGCAGAACGACGTCGTGACGGAGCTGAGATCTCATCGACAGGTAAAACAC
GTGCTTGAGCTTCAGCTGGCGTCCGCTGACCAGCGCACAGATATCGCAGGAGAAGGTGAAGACTGTGCAGAGAGAACGTCACTCGTACTGCGACTAGCTG
CTGGGGATGAAAATATGCTTGCGCAATGGATGCAGGTGCTGCGTTCGTGCATTGACACGTTGGTCTCCCAGGCGGAGACGCAATACCGACTCGGGGAGGC
GGCAGCGTGGCCAGTGACGGAACCAGCCAAGATCATGCCAATGTTTGGGGACGAAGGACGACGAGCGAGTGTACTGGTGACGAGAGAGCGTGGCCGCAAT
GGCAGTGCCGTCAGCTATACCAGCAGTGAATGCAGTAATAATAACCACAACGACACAGACCTCCCCACAGAAGAAATTCGAGCGGCGAGAAAAGATATCA
GGGGACAGGGCGAAGAAGAGACGAAACCAGCGGTGCACGAGATGCAGACTCGAGTTCACAACTACGATACCACGGCACTGGTAATTGGAAATGAAGAACT
ACCAGTGCACTCAGTTGTCGGATACTGCTGCACGCCTGAGCATCGATCAAGTGAGTCATCCTGTTCGCAGGGGCAGGATGCTGACAACAATGCTGCAGAT
GGAAAGGAAAGCAGCAACCAGGAGGACAACCAGGGTGACGAGGATTCTGAAGAGGATTCTGTTGCTGGCGATCTTGCTACACAGAGCTCGGTGGCGCCCT
ACAAGAGCGCTGTTCTGGCGGGGAGAGGTGTTTCTGCCTACCAGAACGTGGGGCTAGAGGACGAGTACTTGAAAATGAGTTCAAGATCGGCAATAGCAGT
TGGAAATGGACGTGCCCGACTTCCTCGGGCTGCATTCGGCGCAACTAGCAGCAGTTCCAGTTTCTTACCGGTGCTGCGGCCACAGACACACTCCTTCAAC
GCAAATGGACAGGTGTTTACTTTGGATACTTGCTATCATCTCGTCAAGCCTATCGGAAATGGAGCGTACGGCGCGGTCATTGCAGTCAAAGACGTAGTCA
ACGGCGGTGACAATCTGGCAGTCAAGAAAATCACAAACATCTTCGAGGACCTGGTGGACGCAAAGCGCATTTTGCGCGAGGTTCGACTGCTCGGACACTT
CAGTCACAAGAATATCACAAAACTTCTGGATCTGGTGCCTCCTCCTTCTCGAAAGCAGTTTGACGATATGTACATCATCACAGAACTCATGGAGACCGAC
CTGCATCAGGTCATTTACTCCATGCAACCAATGTCGGACGACCACGTCAAGTACTTTTTGTACCAAATGCTCTGCGCGCTGCATCACATTCACTCGGCGG
GCGTGCTGCACCGTGATATGAAGCCCAGCAACATTTTATTAAACGCAAATTGTGACCTCAAAATATGTGACTTCGGGCTTGCTCGCGGAGGGATCGGCTC
GTCATCGGGAGCACATCAGGACCTACCGCCGCCTGGCGAGCTGACCGAATACGTGGTCACGCGGTGGTACCGCGCGCCAGAGATTATGCTCAACTGTTTG
CAGTATACTGCAGCGATCGATGTATGGGCGGTGGGTTGTATATTTGCGGAAATGCTGCTGCGCGAGCCGCTGTTCCCTGGAAACGACTATTTGCACCAGC
TCAAGCTCATCATCAAGTTCCTGGGCACACCGAAGCAGGAAGACATTGAATTTGTGAAGAACACCAAGGCTTTGCGCTTCCTCACGAAGCTTGCGATCTC
TAAACCGAAAGGGTGGCGAGAGGTGTTTGCCGGCAGTGGCGCTGAACATGCTGTGAGCTCCGAGGCTATTGATTTGCTGAGCAAGATGCTGCAATTCAAC
CCTGAAAAGCGGATCTCAGTGGACGACGCACTGCGGCACCCGTACTTGGCCACGTTCTTTGATGAGAATGACCTCGTGTCCTCGAAGCCTTTCGACTTCT
CGTTCGATTTGCCCGACGACCAGTTGACCAAGGACGCGCTCATCAACCTGCTCTGCGAAGACATTGAGCAGTTCCATCCGCCTGTGCCAACTTCGGTCGC
ACCAATTCCACTGAGCGCCGCTGCCAGTCGCTTCTTCCGAATGGGAATGACCGCGTCAGCCAGCTAGGAGACAAACACCCACAAAACGCAGGCTGCGTTG
GGCTATCCGAGTAAAATAATTCCACAGTAACAAATCGCCGTTTGCCTGAAATGTTGTCAACTTTTCCTGAGGCCAACCGGATACCCGTCATGCTGTAATT
TTTGGTGTTCGAGACTCGTGCCTCAACAGGCAACCAACGCCTGTCGTGTGGTCTATCGCCAACACTGGCGTACAGGACAGTCTTGCTCGCGTCATCGTCA
GGGCACCAACAGGTTTGAATTTCGCGGCTTCTGGACAGACGTCAGGTCCGTTTCGGCGAGGAGTTTCAGCAGTGCATGGCTTGTTCCAAGCGTGCGCGCA
CCGACAGATATCACGGTGCTGAGCCTGTCCTCGAAGTACGACGTAATGAGCTGGAAGGCGCCGCGCTCTCTTAGAATTCGAGCTGTTACTTGGCGCACGC
CACTGGATATCTGCACGCTTTAAATATTGGGGAACTATGCTTGAGGCCGGGTAAGTAGAAGTCACTTTTCCAATTGCCTTCAACAGCACAGTCATCCACC
TCATCATGAAGTTCTTCGCCCCGCTTTCCGTCGGTGTCGCCCTGCTCGCAGCCCAAGTGAGTGCTAAAGGCGTCTGCTACGACCCGAACCACCACGCCGT
CAGCAATAACATGGATGCTACTACCGTCGCTGCGGACATGGCCATCATCAAACGCCACGGCTTCACCACTGTGCGCACGTACATCTCCCAGTTCGGCTCC
ACGCAGATTGGCCCCATCATTGCAAGCGCCAACCTCACGTCAGCGCTGGGCGTGCCGTACCCCCAGTCGGACTACCAGGTGCAAGCGGCTGCTGCGATCG
CTGCCGCCAAGGCAGGAGGCGTGGGCTACATCTTCGTGGGCAACGAGAACCTTGCAGGTGCAACCACCGTCCCCAGTGACATGGTCAAACTTATCAAGGA
CATCAAAGCACAGGTGCCCAGCACGGTCAAGGTCGGCACCGTGCAGCGCAATACCGAGGTCATCAACTTCTCTGGTATCTCTGGCTGGTCGAATCTTGTT
GGTGCTAGTGATGTACTGGGTGTGAACGTCCACCCTTACTTCACGCCCGGAACGACGGCTAGCAATGCAATTCAAGTCGTGAACGACCAGTGGACAGTCA
TGAAGAGCAACTTCAGCGACAAGCTGGTCCTCACTGAGACGGGATGGCCTTCAGACGGAACACTATCGGGCAACACCGGCACCGTAGATGGCCAGGCGAC
GTTCTTTGGCTCGTACGAAGCGTGGAGCAGCTCCATGGACGAGTCTTTCTACTTCCAGATATTCGACACACCTTACAAGACCAACGCGTTCGAGAAGTCG
TTCGGCTTGCTCACATACGACTCGCAGGACAAGTTCACCTTCAGTTCTCAAGTGGCAGGCACGGTGGCACCTCAGCGCTTGCGCTAAGCGGCATCTCCAG
CCAGCTTGTGACTATTGAAAGGGAGGCTTCGACGTTTATAAAGTACTTGAGTCGTTCTGAAGGGCCACCAAAACACCACAATAACTCGCAATAGCATCTT
CGTGCATATTTCATGGACTTAGCTTACCAGTTCGCTTGCTCCCTTACGGTTTCCGGATGTTGAAGCCGCATTCAGTGATAAATTGCTTCGTGTCGTCTCG
AATAGTGAAGCCGGAACGCAGATTGCACTGGATGCTCGTGTCCAAAGACACAATATGATGATACCAATACGACGGCAGATACAGAACTTCTCCGGCCGTG
AGCGCCACCTCTGCAGCAGGACAATTACGAGCATTCTCTGGAAGAGCACTTGTATCCGACCAATTGAACGAAGTGTGTCGTTGTGACTGGCCTTTGGTCA
TCAACCCCTGGCACTTACAGGAACTCGGCGGCGAAATCACGTATCTCTTGGTTCCACGGACCATGGAAATATGATTAAGCCCGCCGTCAAAATGGCCCTC
TGCTATGATGCCCCTCATTCCGAAACGACAGCGCATGCCGCGCTCCTTGGCTGCAGCTGCGTCACGAACAAACAGGTCCCCGAATCGGATATCATGTTCG
GTTTCCAGCGGGCTCAGGAACTGCAGCTCATCGTAGATGAATGCTGCTCGCTTGGAAAAATCGTACTTCTTGAGCATAAAGTAGTAATACTCATGGGGCT
CGCCGGCCTCCTCGAGCGGCTTGGCGTCGTGCACAGCCTTTACAAACTGCGGGTACGTCATCCAACGAGACTCGTACGGGTCCTCTTCGCCAGCAAGCTG
CTTGCTCTTAAGGTAGTACATAAAGTGGCTGTCGTTAGCCACGTGCACCTTGTACAGCGCCTTCGGATCCAGCTGCCGCGTCAGATACTCGTCCGTCCAT
CGCTTCTTGGCCTCCGTAAGCTCTGGCACCCCGTAGGTTACAAACGGCACCTCCATTTCCCGAAACATTTGAGCCAGACGGAACTCAGACTACAAGAAAC
ACAAAATTGTTAGTCTTCTCTATCAACAACCAACAACCTCGTCCACTCACCGAGTCCGAAACATTGAAATGGCAAATACTGTCGAAGATGCCACTCGGCA
CCTGGTCCGTCTCTTCCGGTTTCCAATTGTCGAACAGTGCAGCGGACGGGAACATTTGCGGGTAAGCGTTGCAGCCCTCGTCCTCGCTCATATCGCACTG
GTACCGTAGCGACGGCAGGTCACATTGGAATTTGTTATTGGCCCCGTTCGGGTACCGATTCGGCAGTGGGCGCTGCAACTGTTGTCCTTTTAAGATCACG
ACGTTGCCGCCCGTGCCCCAGCGCAGAGCGTTCGCGTCACCGCTGGCGTGGAATTTCGCGCGAAGGTTTGAAAGTTGCGACGGCGGAGAGAGCCACAGCC
CCAGCGAGAAAATTGCCAGCACGAACAGCAGCAGAGTGGCAGAGGCCCCGCCGCATTGGCCTTGACGCAGTTGCCACAGGCCGCGGCGGAGCAAGGCGGA
CGCACGGACTTGAACGGGAGATTTGGGCATCAGTTGTGAACGTCGGGAGGAAAATGAAAAATGCGATTTGATGAGGCGATTATCGAATTCACTTGGCGTT
TGTATG