Description :
From Genome Similarity Track
Location :
Scaffold_50:256322- 258711
Transcript NameFunction/comments
Phyin_T30-4PITG_17097Putative uncharacterized protein

Sequence
2389 bases(100 bases per row)
TCGAATGGTTCTCCCTTGCATGCACTAGTGTCGGCGTTAGCAGCGAAATCCTTGTGCTTGTAGCAGGTCTCCGGACACAGCGGAACACCTTCAGCATCCT
TTTCAGTAGTGTAGATCGTGCCGAGGGAATCATCCTTCCAGTCGAAAAGCGAGGCATCGCGCGTCGCCCACCCGACAATCTTCACTTCGATCGTCTCAAA
CGGCCAGCAATCGTACCCAATGAGCCACTCGTTCCACGCCTTAAACTGTCGATTAAGCATGGCCTCGAACTTAGACGCCACTGTTTTTGAGAGCTTGTTG
GTACTATCCCAACGCACACAGTAGCTGAGCTTTCCTTTATTGTTCACAATCTGGTCAAGGATGTAATTCTTGAATTGGGGAACGTATTTCGACATCCTCT
GCGTCCAGATCCAATCCACATCTTCCTTCTTGATGTATGCGTTCGGGTCACCAACGACACACTTGCCGTTTCCAGAGGTGACGTCGCCGAAGGTGGCATG
TTCCCCAGTCGAGTTACCAGATGTCGATGGGGTCTCGGCACTTGATCCCCCCATGGAAGTCTGTGTAGGAAGCGACCCAGTTGCGTCTTCATTTGACCCC
TCGATGGGGCCTTGAGCCGGCAATGACCCGGTGGTGCCACCATTGCTTGAATCCGAGGACCTAGTATTTTGTGTAGGGCTGGTCATCTCTGGCGTGTCCG
GAGCCTCCGTCGTCTCCTCTGTGGGTGCATCCGTCGTTCGCTGGATCGGTGAGTCCGTGACCGTCGGAGTTTCGTTGTCAGGGAAGTCAAAATTTACGTC
AGGCGACGTTGTAGTCGCAGGAGTCGAGGTTGTTGCCTGCTTGGGGTAGCATTTCGCGGCTGAAGTGACGGAGCTGCAGGCAGCTAACATAACGACAGCA
ACGAGTAATAGCTGGATTGTAGAAACTCGAGAAACTTGACACGCCGCCATGGTGGAGAAAATGGCACTGGAGCCAGGGTCGGACAGCGGGAAAGTCGAGT
ACGCCGTGTCGTAAATTACGACTGACATCATGATATTAATTCATGTATGTGGTTACTGTGTTCGGGCTGTACTACGGTATTTAAATCGTGCTTCGTGCAA
CACCGTTCAATAATCCATGGCGTCGCCATAACGCAAAGAAGCAGTGCGGGATTGGCATAATGCATCGCCTCTACTGAAAGCACAACTCGTCGAGCACTCG
ATAACGCAGATAGACACCGGACATTAAACGTACCATCTGGGTCACAAAGTCGCGTACAATTTGTAGCTTACAAACCTACGAGCTCCAAAAAAAGACTTCT
AAGACATCTACTTGAATGCACTGCAGTACCTATTGAGCTGTCAATTTCGGACTACAGTACTAGGTACACTTCTACGTATTATTTTGCTATTATAATTATC
GGCCCGGTATTTCTATTGAACAGATTTGGATATCTCCCGATTTATCGTTTTTCTGTTAGCATTATAAAATCACCCCTCCTTAAAGGAGGTAAAGGAGTCC
TTTACCTTGCAGACTGAATAAGGAACGGGGTTTCAACTAATAACCTCGCAATTTTTATAGTCGGGAAAGATTTAGGGAGATGGGAAAGTGATGGGCAAGG
TACTGACAAAACAATCCAGGCACTGACTTTAATTTCAATTTAAAAAATGGCGTGCAGTAGGTGATCCTCCTTCGCTTCAAGCCCTGCGAGCCGAACTTCA
TTCCTACATTTACATTCAAGCTCACTAGCCGACTGCGTCCTCAGCACCCCATGTCCTCTAATCGTCTCCGCCTCACCTGGTCCGAGAAGGCAACGTCCGT
GTTGAGATGCTACCCCCGAACACCACCGCCAAGATCCAGCCGCTGGATCAGGGGATCATCAATTGCATTCAACGCACATCTTATCGCAAAAAATGATGTT
CACATTGGATCACCTAGGCGAAGGCCTCGACAACCCGTACAACGTCGACCAGTTAGCTGCACTGCTCTGGTGCGATGCTGCATGGTCTAAAGCTAGCGCT
TCCACGATTCAGCACTGCTGGAATCCCTCTGGTCTCATTCAAAAGTCGAATCTTCAAATTATCCTAGCTTAATTCAATACATGCACATGATCCGATATCA
GAGTCTGTTTTTAGCGAGGCACTGTCAGCTTATGCAATCTCTTTCTTAATTTATATCAGGCGTTCCTTATTCAGGCAGATTTCTGTCCACGTGAAAACCT
AAGGGCGCGTGATGCTGTGTCTTTTAAATCCAAGATAGCGGTTCATCACCATCACAATCCTCAAGATAAAAAAGACGGAAGTCATTTGCATCTTAAGGAT
GTGCTCCACTACTGTACCGAGCGCTTTCGAAAAGGCGTTTGCTCACCGAAATCATTTTCGGATTATCCATTCTGTACAAAATGCGTCAT