Description :
From Genome Similarity Track
Location :
contig_74:256315- 258063
Transcript NameFunction/comments
g10056.t1ATP-binding Cassette (ABC) Superfamily

Sequence
1748 bases(100 bases per row)
AAGTACGAGGAGTTCATCAACCCGTGCGTGCTCAGCTGGACCGACCTGAGCTACGCTGTGCCAGGCCAGAAGTCGGCCAAGAACCCGTACGGCAAGAAGC
TCATCCTCGACAACGTGAGCGGACGCAGCGCCCCCGGCGAGCTCACCGCTATCATGGGACCCTCCGGCTCGGGCAAGACCACACTCGTCGACCTGTTGGC
CGATCGCATCAGCTCGGGCCTCGTGACAGGAACGATCGAGCTGAACGGCGTCGACCGCGTGACCAAGACGTTTCGCGCCGTGACGAGCTATGTGGCCCAG
GAAGACACGCTGCTCGGGTCGTTTACCGTTGTGGAGACCATGAAGATGGCGGCCAAGCTCAGTCTGCCGAACAGCGTCGTGATGACAGACATCCACTCGC
GCGTGGAGAGCGTCATGGACGCAATGGGCCTCGCAGCCTGCCGGAATACGTTGGTGGGCGACATTTTCCGCAAGGGGCTATCGGGCGGCCAGAAGCGCCG
TCTTAGCATCGCCATCGAGTTGCTGTCGAACCCCAGCATCCTGATCCTCGACGAACCTACCAGCGGCCTCGACTCCAGCTCCGCCCACAATGTCATGAAG
TATATCCTCAAATTATGCGGGGAAGGCAAGAACGTCATGTGCACGATCCACCAGCCTTCGTCGTTGGTCTACGACATGTTCACGAATGTGATTGTGCTCT
CGGGAGGCCAGACCGTGTACTGCGGCTCGCGGCCCAACATGATCCCGCACTTTGCATCCATTGGCTTCTCCTGCCCCAAGTACATGAACCCGGCCGAGTA
CTTTGTGAACCTCGTGAACACGGACTTTGAAGACCACGTGGACATCACCAAGTTGGTCTACGCCTACGCCCAGAGCAACGTCAAGAAACAGCTACTGGAC
CAGCTCTCGGCGGATCGAGTCACGCTGCAGTCTCTGCCGGACATCGAGCTCAGACCTTCGTCCGCTATGCGGCAGTTCAAGGTGCTCATGTACCGCAACA
CGCTCAACAACATCCGCAACCCGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAA
CGAGCTGACGGAGGAGGACCTGGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGC
GCCGTGTTCGCTCGCGAGCGCGCCAACAGCTCGCTGAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGG
TCATGTCGACGGCGCTGGTGGTGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTTGTGGTGTCCGAGTCCATGAT
GCACGTGATCGGGTCTGCGGTGCCGCACTACATCATCGGCATCGCGTTGGGTGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGTTTCATGGTGCCT
CGCGCCTCCATCCCAGACTACTGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGAGAACGAGACGT
CGGACGCTGCGAAGGCCATTCTGGCCAAGTACGGCATGGAGAATGTGGACGTCATGCAGGACATGCTGTATCTTGCAGCCTACATCGTGGGCTTCCAAAT
CATTTTCATGTTTATCCTGTGGAAATACCACACCGGTCGTCGCTGAAA