Description :
From Genome Similarity Track
Location :
Scaffold_70:2563- 4046
Transcript NameFunction/comments
Phyke_g5469hypothetical protein PHYSODRAFT_515856

Sequence
1483 bases(100 bases per row)
CAGCAATATAACCTCATATTCAATCACGGGAGAGCGACTGCTGGTAAAGCGTGACCTAGCACGTTTACAAGTCCGCCTGGCTGTGTCAGATGTAACCAAT
GGTGAGTGATTTCGTGTTACTTGCTTTCAGTATGGTCCATGCTCTCTTGTCAAGACTCAACCAAGTGGTGCAACAACTCACTTCCGAAAAAGTAGTCAGC
CAGTAGGTTAGACACACCAATGGCACCGGATACGCTCGTGCAGACCCTGCCGCGGTTGCCATCGCCGCCGCCCTATATCAATCGGCCGCGTGTCCCCACC
GCATCTCCTCACAATCGCGTGCTCGAGAATAAGTTCGCGACGGCAACTGTATCTAAacacgaagaggaggaagacgtATTTGTCATTGGCATCCATAAGT
CTCAGCGCAAGCCCGCCATCTCCGCCACGGTCAGTGTCTAAAGTGTCTAACGTTGTTTTTAAAATGTATCACTGATATGCTAAAAAAATCAATTTGGTTA
TTTAAATTTATACAGCACGAGCTCCGTGCACTGCGGTCTGAAGCTGCGTCCCTGGAAGCTCAACTTGCGTCTCTATGCGTGAAATGGCAACAAAGTCTGC
CGGACCAAGTGGTGAGAGAAGGGGCCTGTATggctgccaagaacaagTGGGTCTCGTCCCAAGCGGAGCTCCTCAATCGCTCCCTCAAGGAccagatgct
gcagcagcagctttacCTCGCTTCtctgcagcacctcatgACTCAGAGTCCATTTCTAACTCCCTCTAGAAGCAAAGAGCTATTTGAAGGGATGCACAGC
TTCTCTGCTCTGCCAGCGACTCTGTCCATTCCTCAAAGACTCAATCACTTACAAGCCCAATGTGAATTGGGAGTGAGGCTCGTGCCTGCACTCATGGGGC
GATTCACTCGTCAACATTTGCATGAGGCCACACCCAGCAACCCTTTCTCCCATACCAGCATCATGGCCGATGGAAACTACACTTACGTGTCCAATATTCT
GCTCTGTCGGATCTCTCGTCGCTCGCTGGATGCGGTCACTGCTGCTACGTTGAGTTACTTCCAGAACCTTTCGCCGGAGCTCAGGAGACATTTGGGTGTG
CAATGTGACTTGGAGATGATACATGATCTGGGAGAAATGAGAGGGTACTCACAACTGAGATATCGCAATGGCTCGAGGTTTGCTGCGGCCAGCAACACGA
CGCTGGCTGCGAAGTTTACACCCGATTCGGCGATCGTCGTAGCAGATTTTGTGGATCAAGATGACCGGCACCCTATCGATCGAACGTCGGAGGGCCGTGT
TGGGATGGACTCGTGTCTCTCGTACGTAACGCCATCATCGCTGTAttgtttgttgctggtttgTTGTCGTAGCATAAATTAGGCACTGACGGATGTATTG
GTGAACTGTACAGGCTACTCATGACGCCGGAGAAGAATCTGATGACCGGTTGCGAAGAAGTGCTAGTGCAGCGGTTGACTGTG