Description :
From Genome Similarity Track
Location :
Scaffold_13:256280- 260306
Sequence
4026 bases(100 bases per row)
GTCCTCGTCTGCGACTTGGACCATCTGCAAACGACGATCGCTGCGCTTAGCGCGCAAGTAATCGTACAGCATCCCTCCGCACGACAGGTTGGACGTGGCT
CCCACGTGGGTTCATCATAACCAACCCATTTCACTTGGAACTCTCTGACCGCGCGTTCAGTGCCCGTCGAGAGCGGCGTCCGATCGTCCAGAATAGCCTC
CACCTCGTACTCACCAGTGAAGTGGTCCGGTTCAAAGCTGTCTTCGGGTAGGAGTTCTTCATCGAAGTCTAGTCTCGTCCCATCCGTGACGTCAGTTACT
AACCGAGCCTTCGGTCGGTCCCCATACGCGTTCACTTTCTTCAGTCGAGACACATGAACGACTGGGTAGAATCTATACCCACTCCGGTCTGGTAGAGCCA
GCTCATACGCGTACTCGTCCACCTTCTTCTTGATTCGGAAGGAGCCATGCCAGCGATGTGCCCAGTTCTTCGTTAGCCCCGGTTTCACACGCTCCATGTA
GAGCCAGACACGATCACCCTGCTCGAAGAGCGACTTCGAGGTTTCGGCCGACGAGTCATCGGTCGGGTTCGTCGTTTCAGTGTCTTCACCTGAAGGTTCG
GTTCGGTCAGACGTCGGCAGAGATTCTCGTTCGCGTCGACTCAGGGTCTCGTTATACTTCTCGGCTCGTTTGGCCTTCTCTGTCGCCTGGTACGCTTTGG
CCATCTCCAACGCGATCTCCTGTTGCCGATTGACTTCTCGTCTCCAAGCCAAGGCGTCGGTTTGGCGACGCGGCCTCGTTTCAGTGACGAAGACATAGCT
CGAAGTGTCGTCCGCGCATCCCAGCCGTATACAAGGTAACGGCGTGTCCTTGCGCGTGGCGTCCTGCAAGTTGTTGATAGCAAAGATCAGCTTCTCCACG
ATCTCATCCCAGTCCTGTTGCAGCGGGTCTTCCGGGTACACTCGGACGGACTGTATGGCAGTCTTAACCGAGCGTTCCTGCTGGCCGCTGGCTTGTGGCC
GATAACTCAGGGTGGCCCGAGACCTCGATTGCATCATTTCCGTAAACGCTTGGAAGACTTCGCCCATGAAGCGAGGGTCTCTGTCATGTCGGATGAGGGT
AGAAGCACCGAAGCTTCGGTAGACGCACTCTTCGAAAGCTTGCGTGACGCGTAGGGCTGAGGTGTCGGCCATGGCCTTACCTATTACAAACCCCGTGAAT
ACACACTGGAACAGCAACCGCGCCGGGTTCCCTCGCCGAGTCCTCGACAGGGGAATTACGAAATCCATCGAGACTATCTGCAACGGCCTTTCTGCTAAGA
TGTTGCCCGGCGAGTATCCGCGAAGTTGCGGACGGCTCTTACTTGAGCTACAGTCTGGGCACGAGCCTACGTGTCTTTCGGCGTCCGCAAACAACCCAAT
CCAGTAGTAGTCAGCTTTCCCTCGGTGGTACGTTCGGGTGATGCCGTGATGGCCTCCCTCGAGCGAGTCGTGGCAGCTTTGTAGCACCTCCTGTACCATC
GTGGTTAGTACCACCACCCGCAATGTTGACTCCTCGGACCGGTCACGACCTGACCGACGGTTCGAACCGAGGAAATACAATAGTTCGTCCTCACTCAGCA
CAAACTTATGGGACATCTTCCAGGCCTCTCGTGCTGCTTTGTAACCAAGTTTCGCCTCGTCGCCTTTCAATACCGTCTTGAGGTTCGACCACCGAAGTTC
CTCGTCCTGAGCCGCGCCGATACGCCGACGGCGTTCCTCCTGTACTACCACAGGGTCAATATCCTCAGCGCTCGGTTCGGGAACTACCGTTGCGTCAGGT
CTCGGTTGTGTTGGTTGTTCCGAGGGTTCGGCATCGTCGTCTCGGTCGGGGCTGCGTCCGGGCTACAATCTTCCTGGTTCATCACTTGTTCTTCGTCTAC
AAAGCGGATCCGCCTCTCGCGTTCTCTCGCCTGTCGCCTCTCGCCTGGTCACTACCGATACATATGGCGGTTCCCGCACGAAATCGAAAAAACTCTTGCG
ACGGATCGTATCTGATGCGTCAAGTACTCGGATCGAGCTCACTACACATGGGGTCTCTTCCTTGGACCTTTCTGCTGACGAGGTATCGGTTGGCGGTTCG
TAGATAACCTCTTGGATGCGGTTCAGCTGAACCAGCTCTCCAATCCGAGTCTTGTCGTTCACAGTCACCGAAACCTTTTTTTCAAAGTCTCGCTCGCTAA
AGAGTCTGCTGCAGCGTTGAACTCGCGAACAACGTGCAGGTACTTCACTGACCGAAACTTCGTTCTCAGTTCTTTGTGTCGGGTGAGTTGTGCCATCAGT
GTTTCCTTACGACATGCAATCACCCCTAGGGATTGCTGGATTGCGAGGCTCGAGTCTCCGACGATAACCAACTCCCCAGCCCCGGTTTCTAAGGCTGCGG
TCATGCCGTTGTTCATTCTCGACTACTCGGCTAGATTCACAGTCGTAGCCTCGAGATAAGCACTCGCAGCGATCACTATCGACCAATCCGGCAATTTCCA
CAGAATCCATGCACAACTCCCGTAATCCCCATGTTTCTCAGTTTTAGCACAGCCAGCCATCGAAAGAGAGCACATAGCCACTGTAGTCACGAGGCAGCCG
TGCGTACAGCAGATGAGGATCCATCCGAACACTCAGTGAGCCACGTGTCGGTGGAGTCACTGGTTCCAACGAGTCCTCGAGGTAGACGACACTTGTGATT
GACGACTGGAGGAGTTGTGCAAAGGCACAATCCTTCTCCTTAACGCGCGTAACGACCAAGTGCCACGGAGACAGCAGCACCGCAAACTGGGTCGCACGTC
CGAACAGAGACTTCGACTTGTGAACCCATTCGAGCGTCGAAAACGTGGATGGTCCGACCTGCGAGCTGTGTGTAACACACCTTCAATAACTGCAGCAGCG
TCACAACCTCATTCTCAGCTGGGTGATAGTTTATTTCGGCGTCCTTGGGTACTCGGCCACAGAACCGCACCGGGTGCATCATTCCGTCGTGCTCTTGCAT
GAGCGTTGTGCTCAGGGCCCACTCGTATACGTGAACCGCGCGGTCGCGGTCGAAGTGTCGCAGTATCGGCGCGTCCGCAACCTTCTGTTGCAGTGCAGCG
AAGCTTCGTCTCGGGGCCGAGAGGTCGCCTCCGGCTGAAAAGTCTTCGTCCTTGAGCTCGTAGAGCGTGGCACCGTACACTGCAAAGTCCTGGATGAATC
GACTGTAATAGTTGAGTGAACCCAAAAACGCTTGCACCCCCTTCTTTGACCGTGGAAACGAGAGCTCGGTCAGAGCCTTCAGTTTCTTCGGGTCGCCTTA
GATGCCGTTGTGTGTTACCACGTGGGACAGGAAGTCCACCCGCGGTTGCACGAAGATGCTCTTGGTGAAGCTCACACTAATACGGCACTCTTCGAACCGT
GCCAAGGGTCGGTCCAACGTAGCCAGACAGCTATCGAACGACTCACCCCCGAAACAGATATCGTACACGAAGGATCTTCGCTCGAATACGGGCACCAACG
AGGATCTATCAGGCTCCCCATCGGCAAACATGTCGGCGAGAGAACTGTTGATCAACTCTGGCACAGCATTCCCGACACGACCAACTCCAAGCCCCGCCTC
GAACTTGGTGGGCGAGGGCTAGGTCCGAGACTTCGGTGCAACCGACGGTTCGGTCCGGTCTGGAGTGGACTCCTGGTCATGCGCCTCTGCTTGTTCCATC
AGTGTCACAAAGTGGCTCCATCCACCTTTCGGCTGGACGAAGCCCCGCAGCGCGTTGTCTAGCATCCTCTGATATATCATGGGCGCGTTCTTGAGCCCGA
ATCGCATCCGGAGCCACTCGAAATGGCCCAAGGCGCACACAAACGCAGAGATCTGACGTGATTGCTGCGTCATCATGATAGCCCAAAACCCGCTCGCAGC
GTCAAGCGAGCAGTACCACAATCACATCTCCAGGTCGGTGAGCAGGTCATCGACCAGAGGCATCACATACTCCATGATTGCGGTGATCGCGTTCACTGTG
ACGGGGTCACACAGCACAATGCACAG