Description :
From Genome Similarity Track
Location :
contig_74:256263- 258011
Transcript NameFunction/comments
g11847.t1XP_008906109.1 hypothetical protein PPTG_12163 [Phytophthora parasitica INRA-310

Sequence
1748 bases(100 bases per row)
AAGTACGAGGAGTTCATCAACCCGTGCGTGCTCAGCTGGACCGACCTGAGCTACGCTGTGCCGGGCCAGAAGTCGGCCAAGAACCCGTACGGCAAGAAGC
TCATCCTCGACAACGTGAGCGGACGCAGCGCCCCCGGCGAGCTCACCGCTATCATGGGACCCTCCGGCTCGGGCAAGACCACACTCGTCGACCTGTTGGC
CGATCGCATCAGCTCGGGCCTCGTGACAGGAACGATCGAGCTGAACGGCGTCGACCGCGTGACCAAGACGTTTCGCGCCGTGACGAGCTATGTGGCCCAG
GAAGACACGCTGCTCGGGTCGTTTACCGTTGTGGAGACCATGAAGATGGCGGCCAAGCTCAGTCTGCCGAACAGCGTCGTGATGACAGACATCCACTCGC
GCGTGGAGAGCGTCATGGACGCAATGGGCCTCGCAGCCTGCCGGAATACGTTGGTGGGCGACATTTTCCGCAAGGGGCTATCGGGCGGCCAGAAGCGCCG
TCTTAGCATCGCCATCGAGTTGCTGTCGAACCCCAGCATCCTGATCCTCGACGAACCTACCAGCGGCCTCGACTCCAGCTCCGCCCACAATGTCATGAAG
TATATCCTCAAATTATGCGGGGAAGGCAAGAACGTCATGTGCACGATCCACCAGCCTTCGTCGTTGGTCTACGACATGTTCACGAATGTGATTGTGCTCT
CGGGAGGCCAGACCGTGTACTGCGGCTCGCGGCCCAACATGATCCCGCACTTTGCATCCATTGGCTTCTCCTGCCCCAAGTACATGAACCCGGCCGAGTA
CTTTGTGAACCTCGTGAACACGGACTTTGAAGACCACGTGGACATCACCAAGTTGGTCTACGCCTACGCCCAGAGCAACGTCAAGAAACAGCTACTGGAC
CAGCTCTCGGCGGATCGAGTCACGCTGCAGTCTCTGCCGGACATCGAGCTCAGACCTTCGTCCGCTATGCGGCAGTTCAAGGTGCTCATGTACCGCAACA
CGCTCAACAACATCCGCAACCCGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTGAGCACGAACAA
CGAGCTGACGGAGGAGGACCTGGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCATCGAGCAGCGC
GCCGTGTTCGCTCGCGAGCGCGCCAACAGCTCGCTGAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTTCGTGATCGCGG
TCATGTCGACGGCGCTGGTGGTGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTTGTGGTGTCCGAGTCCATGAT
GCACGTGATCGGGTCTGCGGTGCCGCACTACATCATCGGCATCGCGTTGGGTGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGTTTCATGGTGCCT
CGCGCCTCCATCCCAGACTACTGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGAGAACGAGACGT
CGGACGCTGCGAAGGCCATTCTGGCCAAGTACGGCATGGAGAATGTGGACGTCATGCAGGACATGCTGTATCTTGCAGCCTACATCGTGGGCTTCCAAAT
CATTTTCATGTTTATCCTGTGGAAATACCACACCGGTCGTCGCTGAAA