Description :
From Genome Similarity Track
Location :
Scaffold_254:25623- 26631
Transcript NameFunction/comments
Phyta_totarag6239hypothetical protein PHYSODRAFT_558872

Sequence
1008 bases(100 bases per row)
CGACGCAGATCGGTTTGACGGCGACACGCAGCAAAGTGGAAAAACTCATGAGCGGCTTCACCACtttcgacgacgtcatgCGCATTGGAACGCGGGTACG
ATCCATAGCGAGAATCAAACTTAAGCCTTCTACTAACTGGTTACGGGTGGGTGTTTGTTCGTGTCTGCTTCATGTAGCAACGTCGCGAGAAAGACGAATA
TCGTTTGGCTGAAATGCGACAGGAGATGAGTCGCCTGGAGCACAAGCTGGAGgcggagatcaagaagcgtATCGAGATGAACAAATCGCTCCAGAATTAC
TGCGACGAGCAGGTGGCGCACATGACGGCAGCCTTCGAGACTCTGTTAAGCGACCGTGCTAAGCAAGTGGACGATCGACTTGACCGTCTCACTCATGAAA
TCAATGATCTTCAGGCGCTTGTGGCCAAGGAGAAACACGATATTCCTCTTATGATTGAGAATAAGACGAATGAACTAACGCAGAAGCTCATCGCATTCAT
GGATGCCTTCGAGGAAGAACGCCAGCGACGCTCGAACCAGGAAGCGAGGCTTTTGAAACGTTTGAGCGATCATGAGCATGCAACGGCTGAAAGCTTTGAG
CGTGAACGGGTAAGACACGCGCCGTCAGAGATTTTAATGTTTGGTGTTGCTACAGATTTCGGTACTAATTGTATTTTTGCTCTTCGTTTGACAGCATGAT
CGCGAGTTGAAGTACTCCGAGCTAAAGAACGCGCTGGACACGTATAGCTCTACTCGGATACGTGGTGATGAAAGGTTTCACGCATTCGCACAAGAGGAGA
TCGCTAAAATTCAAAACGCATTGGTCGCCGAAGCACAGGTACGAAAACGTGCACACTTCGCGTTATTCTACTTTACTAACGCAAGCTGGGTTGGGTTGCC
TCTCGTTCTAGGCTCGCGAGCGCGAAGACGATGAAATTGTGGAGGCTCTCAACCGCTACACCGCCAAGCTGCAAGATAGTCTCAAGGTCATTACGAGCCC
AGACGCGT