Description :
From Genome Similarity Track
Location :
Scaffold_1368:2562- 4372
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1368-snap-gene-0.6Leucine-rich repeat-containing protein 56.

Sequence
1810 bases(100 bases per row)
TGTGTCCACAAACGCTTCTCGAAGGCTCACACCATTGCGTAGCACCCCAGCCGACGTGTTTGGTCGACGTTCGGACATTTTCGTGTGGTTCGGCGTCTTC
CGCTTTATGCTTGCTTTGGAAGGGCTGCTGTCGTGTTCCCGGTGAGAAGAGACGTGAGTCGCTCCAACTTGGGATACGATGCCTTCCTGCTGCCACGCTT
TGAGCTCATTCAGAATCGCGTCTCGGGACTTGTGCTTCTGAGTCTCGAGCTCGTTTGCACGGTCCAGAGTGTCCGTGATAGACACCCGAGCTGGCGTTTT
TGGTCGCTCAAGGACAGTAAATTGACTGATGCTCTCGTTGTTAGAGAGTTGACTGCCTTTCGACACGGAGGCAGGAATACCTGTGATATTCTGCTGAAGT
TCTTGCACAGCAGGATTGTTGAACTGAGAGTCAGGTTCGCTCTCGCTACGATGGCGGCGCAGAGCACTCGTAACGTTCCCCGCAAACACGATATCCGTTC
CATGTGTCAAGCTACTCCCCGAATCACGTTTCATCGCATCCTAAGGGGCCAAGAGTAGATCGCATTAGTTTTACGATCAGCAAAGTCGCCGCTACCCACG
CATATCGAAACCCTTACAAGTGCTGGATCAAAGCCGACAACGCGCTGCGTACTGGAGCTGCGCGATAACCTGCGGGGGCTTCGATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCATCGGCGATCAGAAGCTTGTCGTCCACTGTCGCTGGCGCCAGACTCGCTGCGGCCAGTTC
ATCTTGATGGGCTTTGATCGCTGCGTCAATGTCGTCGTCGGAGATCTTCGCGCGTTCTTCTTCCGTAATGGATTTATCGTCCAATGTCGTCAGTTGAGGG
AGAAAGTTGGCCACAATCTGGCGGTAATGTGCGATCTTGCAGACTGGATTAGCTTCCAAGTTGAGTGTCGTCAACTGTGCGCAAAATGCTAATGTGGAGA
AGGCGTTGGTTATTTGTTTGTTCACTCATCACAGCACGAAGAGAGCAATTTTGGGTCAAAACTCACCTAGTTGCTCGATTTGGCCAACATCCGAAACGCA
ATTCCCCTCCAAATCTGCCAAAGAGCATGAGTCCAGCAACAATTACAATCGCACATCAACGTCCAGATGCTTGAAAGGAAGAGTTGTAGTACCTATGACT
TGGATCTCATCGTGCAGCGTCAAGGGGCTGAGGTCGCTGATGTCGTTGTACTGCAAATACAATTCCTGGAGACCTGTGAGCGCGCCGATGCCATCGAGGT
CGCTGATGCCACTTCGCATCACCCATAGGATCTGCAGCGAGTGCAACGACGTCCCCAGGTCGCGGAAGCTGTGCAAGGTGCTGTTTTGCAGTTTGAGCTG
CTGGAGCGACGGCAGCAACTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGACTGCTTCCCAGAGTCCACTGATATCTGTAGGTACGTCACGCGC
GACAGATCCTGCTTCCCACTCAACTTTTGCTATTGAACATGCACAACATAACAGTTTAAGAGCCTTAGATCACATAGAGAGTCGCTATATGAATGAAACC
CATCGTACCAGCTTTTCTTCCGTGATGTCGTCAAAAGGGTTATCTGGGAGATGCATCTCAGTCTCAGCCGCAAGTGCCGAGTGCTTCTTGTTGGTAGTAG
GCGACAAAAGCTGCGCACCGTGCGCATTTCGCGCCGTCACGGGCGTCGGGTTGCAGTCCTTGGGTAGCGTGCGGATCATGAACCGGGCTTTGCTCGGCTC
GATCGGCTTC