Description :
From Genome Similarity Track
Location :
Scaffold_2360:2562- 4220
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2360-fgenesh-gene-0.2Loricrin

Sequence
1658 bases(100 bases per row)
CTCCTCTCCACTCCTCCCTCTCCTTCTCCCGCGTCTTCTCCACACAATGTGTTGTCGATCGGAGCTGGCACAGTAAACTGCATTACTTGGCCTCCGCTTG
ACGCAGGTGAGCCGAGCACAAGCCCTTGCGACGACACGGCTTGCCACAGTCGCCCTGGGTGCAGCGCTTGCCGCCACCGTGGGTAGCGCACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCGCCGCCGCGGTCGTTGCGCATGCAGCCCGTGACTTCGCACAGGCGCGAGCCACCGTGCAAGGCACAGTAGTCACCGCGCTG
GGTGCCCTTGTCGCAGCCGTCAAACATGCAGCGCTTGCCGCCACCGTGCGAACGGCAGTAGCCACCGCCTTGCGAGCTGCGGTGGCAGTTGTCCACCTGG
CAACGAGGACCACCGCCGTGGGCCTTGCACAGGAAGTTGGACTGCGCAGCCTTGTCGCAGCCGTCGTGGCTGCAGCGCTTGCCGCCGCCGTGGCGGATGC
AGAGGTTGCCGCCCTGGCTACTCTTGTCGCACCCGTCGATGGCGCAGCGGCGACCGCCGCCGTGCGAGATGCACATGCCGTTCGAGCGGGAGCGCTTGTA
GCACCCGTCAGCGCGGCACAGGCGACGGCTCTTGACTTCACCGCACGCCTTCATTTTCATCATGCTGCCGTCCGGGTTGCACGGGTGCGGCGACATCTTG
AGTTCGTCGTCGGTGAAATCTCCGTCCAGGGAGTCCATGAGCGACTCGATCGGCGAGCCAGTGAGCATGTTCAGGTTCAAAATTCCGTCGTCTTCCTCCA
ACTCCAACGCCTTCTTCGCCGACATCTTCTCCTCCGGGGTGTCCACCAAGAAGCTGTACAGGATCGACATTTCGGTCCCGTCAAAGCCGTCGTCGAGGTT
CACGAGGTCCTCCTTGTCCTTCTCCGCAACCTCGAGGTCGTCCGGCATCGTAAAGTCGAGCAGCTCCTCGAGCTCGGCGGCTTCAAAGTCCTCGTCTTCG
TTGTTGTCCTTGCCGTCGAACTGTTCATCATTCAGGCCGAACGCCATCAGGTCGCTGGCGCTGTTGTTGACCGACGGCGCGTTCATCCACGGCATCGCGG
GCATCGCCGGCAGGTTCTTCGGGAACGACACGAACGGCAGCGCCGGGGGCGCCACCATGGACAGCAGGTTCGCGCTGTCGGCGGCCGATCCGAAGGGGGT
GAGCGAGGGCGAGCTCGTCGCCCAGGGCGGGAAGCTCGCGACGTTGCCCGCCGGGCCGCCTCGCATCATCAGGCCCTTTGGGTTTGCCATCGTCATCATC
ATGGCGGGGGGTTGCTTATTCCCTGTAGGGTGCTGGTACCCGGCGAACAGCGCTGCGGCTGCCGGGCCCATGGCCCCCAGAGAATCTCTCGATTCAATGG
GTCGGCACATTCTTCGTGGCCAACTCGGTCTCTCTCACGGGCGTGTCGGACGCCTCTGCTTGCGTAGCTCTTCTTTTCTCTTGCGCGCTTTTCGCGTTCT
CAAAGAAACACGACGCGGCTTTTGATCTCTTTGATGAGAGCGAGAAAGCTGGAAAGAG