Description :
From Genome Similarity Track
Location :
Scaffold_4:256139- 257354
Sequence
1215 bases(100 bases per row)
ATCGATCATTTCATGGTGTATGACTTTGAGGCCATTCTTAAGCCTACCGCTACTCAACACGGGGAGAATACTGTCTTTACTAACGAGCATATTCCTGTGT
CAGTATCAATAGCCGATAGTTTAACTGATGAGGTACGTTGCTTTGTAAATGATGATCCAAAAGCATTGCTTACTGATATGTTCAAATATATTGGCGATGT
ATCCTTAAAGATTCGACAGTACAATGTCTCCAAGTATGAGTCTCTGTTACGAAAGATCATTAACGCTCACGGTCTGACGGGTATGGAGATCCCCGACACC
CCTCTTGGTAAGACATACAAGATGTCTGACGTGGAGAGTTGGATTGGAGAAGGAAAATATTCCAGTTTCTTCGATTTCCATAACAAAATTGGATTCGCTA
AGCAGAGATCAGATTATGGTAAAATCAAGCAGCAGCTTGATCAGGTACCAGTATTTGGCTTCAATTCTGGTCGATACGATATCAACTTGATTAAGAGCGA
CTTGTTCGCTGTGATTGGTACCAATAACATCAAATCTGTCATCAAGAATCCATCTTACGTGTGCATAGCAACTTGGAACATGAAGATACTTGATATCAGC
AACTATGTTCCGGCTGGCACCAGCTATGACAAGTATTTGACGACCTATCTCGGTGGATGCAAGTGTGAGGACAATATTAGCTGTGTTTGTGGGCTTGATA
AGGGTATTTTCCCGTACGAGTACATTACCAGTTTCAACGTCCTAAATGAAACTCAAGTCCCACCGAAATCAGCTTTGACAGCAAGCTTCGTGGTACAAGC
ATCTCCAATGATGAGTACGAGCGTGTGAAGTTTGTCTGGGGGCACTTTGAAATGAAGTCAATCAAGGATCTACTCATCTGGTACAACAATCTCGATGTAG
TTCCATTCATCAAGGCTATCCAAGCTCAGCGTGAGTTGTTTAAACGTTTTGATCTGGATATGTTTGTCGATGGTGTGTCTCTACCTGGTCTATCGGAGAA
AGTAATGTACCAGACTTGCTTCAAAAATCTACAATACCCCAGCAAGAAGCCTGCTAAAGCGTTCAAATTCCCAGCCAAGCGTATGGTTGGCTACAAGAAT
CAGGATGATAAGGCAAAGCGAGATTTTGGTATGACACTTGATCACTTGAATAGATTGCTAAAGCATCAGAAGTACCTGTGTGCTTTGTGCTACAGTCAGC
TGACTTGCGAAACTG