Description :
From Genome Similarity Track
Location :
scaffold_58:2561- 3972
Transcript NameFunction/comments
Pl_110870hypothetical protein PHYSODRAFT_470654

Sequence
1411 bases(100 bases per row)
CTTTCATACAAAGACTCTCGTAGAACTGCCGCCCAGATCCGGGACTTCTCTTGTCCAGGAATGCCATTTTCTCGAGTAACTCTGCGTCGCGGGCATTCGG
ATAAGGCATGCCCACCATCACAACGCATCGTGCCAGGTCGTCACTGAAATTAATTCCTTCAGACATTTTGCCACCAACTACACTTAGAAGCATGGCACCG
CTCCCATTGGGGTTACCTCGCGAACATGCAGCTGAATACTGCATGAGCACTTCTGCAAGTTCGTCGGATTTCTTTGGCTCACTGAATATGGATTTCTTCG
CTTGAATTTGCTCGTACTGTTTTGTCGCTTGCCATCGACGGACTGCATTCTCTTCAAAGTGATAGGACGGGAAAAATACTACAACTCCACCAGGCACAAC
ACGTGAAAGATTTAACAGGATGCGACCCAGCTCGTCCAATGCTTCCAAGTCACCTCGTCGTGAATATGTAAATTCAAGATGCTTGTGGGAAGGACCCGAC
GCGAGGCTGAAGCCCAACAAATTTTTAGGAGGGATGACGTGCCCGCATGAAAACAAATCAACGTCTTCTTTTGGCACCGACGAGAACAGTTGATCGATCA
CTTGGGATACCTTGCAGCACGACAGAGAAAACGTTAGTACAAATTTTCTAGCCCCATAGGATTGAGTGCCTGCTTACCGGCTGCATTGTTCCTCCAGCGA
GAATGACGCTCCGTGACTTTTTTACTATTTCTTGGAAGTGGATCACGGGATTCAACAAAATAAATTTGATTAAGCCTTCAACTCCCTTATTTACCTAGAA
AGACACGGCAACACATAGTTAGGTAAAAATTACAGTGAGAAGTATAATTTAGCGTGACGAACATTATGCGGTTGTGCAAGAATTCGGCCATCTCCACCGG
CGCTGGTTAAAGCTTTCAGCAAAGCCTCAACTGTTCGAAGCGGAGAAATGTGGCGGCTCTCAAAACCTTCGTCGGTATCATCAGCACCTGCAAGCGGTGG
AGGGGCAATTACGGGAGCACCAGTATTCCTCGAGTCCACAAAACCCATCAGCTTCTTCGCCAGGCCACTCTCCCTAAGATACTCCAAAATTTTGAACATA
TTGAAGTGGTCTATCCGCGCACTGAACAAGAAATCATTGATCGTCATCATCTGTGCTCCCGTGACACCATCATCGTCCTCGGTCGTCGAAGCAGGTTTCC
CAGCAGACTTGCTCAGTTGGCGAAGAAACTTTGTCAAAGACTCCAAGATCGATAATAGTTGCTTGATGTAGAAAGCGTTCTTACCCTTGAACCGTTTCTC
ATACTTCGTAAAATATGACCACAGAGTTCTTCGTGCTACCACCAACTGCTTACTGGTGATTTCGACCTTGTATGTGTTGCTGATTGCATCGATAATGTTG
TGTGCCTCATC