Description :
From Genome Similarity Track
Location :
Scaffold_238:25605- 26692
Transcript NameFunction/comments
Albla_Nc14105590Chloride Channel (ClC) Family putative

Sequence
1087 bases(100 bases per row)
CTTGCATGACTTCCCACGCTGGAATGTCATACGCCGCTTTTGGGAGTTTCTTGAGTCGAGGAAGATTACTCGTCATGATCAATATATCATAGACATTCTC
CGTAAACTGCTTGGAGGTAAAATAGGCGGCCAATATGGCCAGCGAAATTGGAAGGTTGAGTGAGTCTGTATGAGATATCTCCATTATAATTACTGCGGTT
GAGATAGCGTGCGTGACACCTGACGAGAAGGCACCTGCCCCGATGATCGCATACTCAAATGGCTCATACTCGGTCTCCAAAAGATCAAATGCGGTGATAG
CTTCCCCTACGAGCCTTCCAAAAATGCCACCAATAACAAACGTCGGTGTAAACAATCCGGCTGGGAGCGGTAATGTTACGCTAAGTAATGTCAGTACAAA
CTTGAGCGGAAGATACGTCAAAAGCGAGCGAGATAGTTGGACACCAGAGTCAGTAAGGGGAATACCAGAAATAGAGGCACCATGCCTGCCGAAAGGCTTC
TCGGTTCGTGAAAAAAGAGCCCCGAGAATACGATGAGGAGCTCCGTGATGGATGAACCACGCTGGGTCGCCATAAAACTCGCTTATACAGCTGATGAGCG
TAATAGATGATACTATTATTAATCTCTTCAGTAATCCTTGCCAAAATTTGCTTTTCCTCATAAAGCGCCCAATAGCGACAAAATAGCTTGAGGTCGCAAG
GTCGATCCCGACATTTTGGTAGAATTGCTGATTCAAGAATTTGTCGCGACGACGCACAATCATGGATATACATGTGTTGAACAAAGCTCCTCCAAGCCCG
CAGACAATTCCAATCATGACGAAAACTCCCAAGTCGTATGCGGAAAACCCATGCGATATTTCAACGTCAGAAATGCCTAAATTGGACTTCCCAAAGAGCC
CATATCGAGCGTTCGTGGTCGCGAAATCAACAATCAGGGCTCCAACAATGGAAGCAAAGAATGAGCGGGGAAGAGTTCGCACCAGATAAAAATCTGAGGT
GACTTCTACGCCGAAAAGAACACCTCCAAAAGGTGATCCAAACGTTGCTGCTACTCCGACTGCACAAGCACAAGCCAACATCTCGAG