Description :
From Genome Similarity Track
Location :
Scaffold_14:256045- 258657
Sequence
2612 bases(100 bases per row)
AACCAAGCAGCACACGTGCTGGCAATCAATCCAACATACATCCGTCAGACCCGGCACATTGATCTCCGCTGGCACTTTGTCCGAGAGCAAGTGCAGAAGG
AAGTTGTGGATCTCTACAAGATCAAAAAGGAAGAGAACCCGGCTGATACGTTTACCAAGCCCTTGGACAAGAACAAGTCGAAGGCCTTGTTGGATCTTGT
GGGCGTGTGTGCCAACTAATCCTCCATCGCACCAAGTTCTGCAGCGTGAAGATCAAAGCTTATGCTTTGAAGAAGGCCTGTTGGATTGCATATCGAAGAC
CCGATGTCAGAGCTAAGCTCTATGTGGGACCTGGTCTACGAGCTCGACCAAGCTGCAGAGAAGCAGAGAGACATGAGCTTCTGTATGTGAAGAGGACACA
GGTCCTTTACTGGCTGGCAATGTTTGGTGGGAGAACTTAAGGCATCTACTTTAATTCACTTCTACTTTTCCCTTCTGTCCGGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAGGTCTCTACATGAT
TGACATGATATAAGAACCAGCTACAAGGACACAAAGAGATTGGATTGTGTTACGGGAGCAGCTTGAGCATGCTTTGGTGCTGTGTTGGTGTAGGGTCTAC
AACTCTGCCGATGGTAAAACGCTGATGGTAGGCACTGATGAGACTATTCAGCTTGGCTTCGCGGTGCATCTGCCGAAGAACCTTAAGCACAGCGTTGGAT
CCCTTTGACGGTACGCCCTGCTCGCCTAGGAACACTGTGACTTTGTTTGACGCTAACTCTCCGAGCTGACGTACTGTATCTTTGTAGCTGGATGATAACT
CGTCGAGCACGTACCCGTCTTCGATGAAGAGCCTCATGAAGGCCACGAGCTGCTTGGAATCCGATTTCTTGTGCTTATTAGTGTGGTGTAGGGATTTCCA
GATTCGACCATACGCCGACCTACTTTAGGTCAAGAATCGGCTCGGTCTGATAACCCAGAGCTTAGGAGCCAAGGATCACGGTAAGTACTCGGCGATCTGT
CCGGATATGCTATCCGGATAGCCGTTGAGCTCAACGGCCGCCTGAAGAGTCGGTAGAGATCCGAAACGACTACATTTCACTAGATATTTGTATGAGAAGC
ATAGGATTAAATAGGAGGAGCCCGAAAAGGCTCCCAGAAGATAACAGAGCAGAATTTTCCTAGTCCAAGACACGTGTACACTTTTCCGGTAAGTCCCTGC
ATAGGGCTGGATTATGCCTGCCGTCAATACTCGAGAGGCATAGCTTGTAGGGTATTGACTGGTAGCGCCAAGAGATTAGGTCGGTCCGGGTAGGACAAAG
TCTCGCTACGCGCGAAAGAAAGTCCCGCATACTCAGCGGGCCGGTACGTCGGATAGCCCGGGTGCCGTAACACTTCTAGCTGAGCAGCCTCTGCGCTCGG
TGACCTGTAAAAGCGCTCGCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGTGAACGAGCTCAGCCGAACCAAACTCGGCGGAGCCTCGGAAG
TGATCTGACTTGGTTAGTCGGAACCGAGTGGAAGCGAGCCACTCGTCTGTCCCGGAAGGGCCGGACCGCGAGGGGACCACCCTCTGCGCAGGCCATACAA
CCGCCGAACTAACTCGGCGATTCGTTGTGGTTTGTGTAAGGAATCCACATCTGACGGTATTTGTGTGTTCTACTACACCACAACTGGTGCCGCGACCCGG
GAACAGGAGTGTGTGCTTGTTTTTATAGGTGCCAGCTAACCAAGTTAAGAGGAAGAGAAGAGAAAGAGAAGAGTGAAGATGGTCAAGGGATCAGCAACTC
CGAGCGACGGAAGCCCAGCGACGGCTGGAGGATCGCCTCTCGTGGGGTCGGACCCGGCGGATCAACGACTCATCGCCATGACGATGGAGGTGGGACGAAC
CGTCCAGTTCGACGAGGATGGCCAAGGCCAGGAGAGCGAGAACGGAGACGCAAGTGAAGGAGAGTATGAAGAGAAGGCCGAGACCGCTGAGCTCGGAGAA
ACGAAGACTACCGCCGAGCTACTTGGCGAGGTGGAAGAGTTGACGCTGCAGGTGGGACGCATGGGAGCCCCACGTCCTGTCGAGCGCAATTTATCCGCCG
AGCTCGACGAAGGTGCGGACGATGAAGAAGATGAAGAAGACCATGGCGTTGCTCAAGGGGACCGTCCGCCCCTTATTCCAAAAGCGACGAGGAACGCCGA
TACGCCGAGCGCCAATAAAGTGTTGGCTCGACTCGGCGAGGAGATGAGAACGAGATCGGAATGGATGATGATGTTCGCGCCTGTGGCGATGGCGCAGGCG
AAGTGGCCGATGTTGGGTCCCGAGCTAACTCAGCCGGTGCGTGCAGCCAACATCAATCAGTTGGTGGAAGAAACTGTGTTGCTGTTGAAGGCGATGGGCT
ATCGGTGCAACAGCCGACCAAACAGCCTCATTCTGTCCGACTGGAGTCTGACCCGTGGCGGAGCCGAGCTCTGGCAATGGAAGAAGAAGCTCAGAGTGGC
GTTTGGATTGGA