Description :
From Genome Similarity Track
Location :
Scaffold_201:25603- 26640
Transcript NameFunction/comments
Phyta_totarag5496hypothetical protein PHYSODRAFT_478810

Sequence
1037 bases(100 bases per row)
GGCCAACCACTCGAAAAGTCCAGCTTGTTCCAGCCAAACTGCTTCTGGCCATCTGCGTAGCCGATAGTGGTGTTGACATAGTGATAATACAGAATGGGGC
CGTAAGTCGGGTCGTCGTACACGCTCTGACCGCCCGGGCCGTACACGTTGCCGTGCGACTCAAGAACGATCGTACCGCCTCCCTCGGTACACAGCTTTCC
GTCTGCGTCATGGAAATCCATGCTGCCGGGCTTAGAGCGGCACACCTTGATCTTGTACTCCTCTCCGGCTGCTGGTTTCTTCGTgtcaaagctgcagcag
acaccATGCGAATAGAATAGGTAATTGTAGTCGCCAAATTTGAACATGTTGGCGCCTTCGTCAGCGTGGATGCCAGCGGGCTCGTACGCGAGCTTGGCGT
ACGTGTTGGGGATCGCAGAGGTGGGCGGGTCATTCATTGCCACTTGAAATAGTCCATCTACGTAGCTGCCGAAGACCATGTAGTTATGGCCATCTTCTAC
GAACAGATTCGGGTCGATGGCGTTGTACTCGCTGGAATCGTTGCTCTGAACACCAGTCGTCCCGAGGTCCTTCCACGACCCAACATTCAAGGTAGTCGAG
GTAGCAacgccgacagcagcaaggtTATGGCCGTCAAAAGCCAAAGCTCGGACAGCGGAATAGTACAAATAGTACGTGTTCCCCACAAGGTGAACATCCG
GGGCCCAAGCGTCCATTTTGCCGTCCCAGAGTTTAATACTGGTCCCATCAGGCAGCACAGCACCCTTGTACTCCCATGGCCCAGTGATATCCGGGGCCGA
GTGGACAGCAATTCCTCCTCCCGTCGAAAAACGAAAGTACGTGCCGTCATCGCGACGGATGAGGCTCGGGTCGTGGGTGTTCACACAGACGCCCGAGCAC
GCACCGGGGTTGACATACGCGCCAGTGCACCCAGCAAGGAGAGGCCCAGCGTCGCAATGGGGAAGAGTTTCACCATGGTATAGTAGTTCGTGGTTGGAGC
GTTTGTTGTTCGTGTTGACGGCAAGATTGGAAATGAA