Description :
From Genome Similarity Track
Location :
Scaffold_80:25601- 32211
Transcript NameFunction/comments
Phyke_g3623hypothetical protein PHYSODRAFT_485908
Phyke_g3624hypothetical protein PHYSODRAFT_555387

Sequence
6610 bases(100 bases per row)
TTTATTGTTCGAAACCTCGTAACGTCCCAAGACTtggaagatgaggacgaggcggAAGAAGTTAAGGAGGAAGTTATTGGAGACTTTAAACGCTTCGGAG
AGCTGAGAGACTTGACAATAATTAAAGAGAATATCGATGGGGGGGAGGTCGGGGATGTGGTCATAGTGTTTAAGGATGCAGAGAACGCTAAGGTGGCGTT
CAATGCCTTTAACGGGAAGGTATTTGGTGGGAAGACTGTCGAGTGTAAATGGGTGGTGAAGGCAGCGATTGTTCGTGGGATGGTTATGGCTGAAGAATTG
GAGGATccagatgaagctgctgatgtggaggaagaaatgATGCAGGTGTTAACCAAACATGGAGCAGTGAAGGAATTGCAGGTGAATAAAACTACTGGGG
AGGTCACCGTGTCGTTTTGTGAAGAAGATAGTGCTGAAAAGCTGGTTGCAGCAATAGATAGGTCGCAATATGGTGGCCGCTTGGTAACAGCGAGCCTGGT
GGAAAGTGCTATTGCTGTCGAAAGTGCGAAATCATCAATAGAAAAGGAAGCGAAACAATGCATCGCCCAGGTACGACGCACTACTGACGGAATAGTGTGC
GGATATCTGCTAACGGAGTTTGTTGTGGCGGCTATGCTTGAAGGCAACAGAATCTACCGATATGCAAGAGGTCGTTAAAATGTTTCTCAAGCGCCTCGCT
TCTCTGCAGGTAAGACGATAGCCAAGCTATGGATTGAAAAATTACCGGCTCAGTGCCCGACTAAATGGCGGTGCATGACAGGAACGTGCGCACATTCAAA
ACCCTCAGCATGATAAAAGGTCTCGGCGGGTAGTGCTCGGAATGCATGAAGTGCGGCGCGGACTTCTTGGCAACAAAGTTCGTTTGTTGATCATTGCTCA
TGACCTAGAAGCCTGTGGGCTACTGGACGACAATATTTCCGAGCTGATGGAAATTGCGACGAAGCAGGAAGTGCCTGTAATCTCTCCCATGAATCGGTTC
GTACTGCGATCGCGGTAGCGGTGTATGTCTCCTAAGCGAGTGAATTGAACAGCGAGCTGATTAATATCATGACTGATCGACTGAATTGTACAGGAGAAAG
CTGGGGCGTGCGCTGATGAAAAGTGTGCGTGTGAGCTGTATCGGTGTTTACTCTGTTGAAGGTGCCAACGATCTGTTTCAGCAGATCCTAACAATGATGA
GAACGACTGCCCATAGAAAAATGGGGTGATCTGTGCTCTCTTCGCCTTATTGCGTTACCTTGCACCGAGAGATGTTGCCGAGATGCCAACAGCCGTAATA
CTGCCTAGGCTCAATTGTATCACTCTCCTCACGTGATTTCCTGCGTAACGCTGGATTAGTTTCTTGCAACCTCGTCATCGCAAGATTTTTTAGCTGGCAT
ACCTCTTATTTTTATTAGCTGCAAACTCATTGATGCGGTAGCACGCCTGGAGTTGGCACCTCGCAATGGTCTCGTTTGCCATTGTCATATACTGGAAGAA
AGCTGCATCTTCGGACATGGTCGTGTCGTTCAGCAGAAAACGAAACTGGAAGTCTGCGCTTGCGGTTTTGCTTTTGGCGAGTTGGTCTTTTAGAAACTCC
AAAAGTTCTGGCAGCGGATGGCCCTCACGAAGACCTCTTGCGATCATATATCTCTCAGAGCTTGCAGGGCGACTAGTCTACAGCACAAAAATGACAGATG
CGTGGTTAATAGTCGCTTTGATCCATTTCACGTGCAGTACTCAAGACATTCATGCCGCGTACGATGGGCTTTACAACTGCAAACTGGTCAAAACACTGAT
GCAGTATCCAGCATAGTTGCAGCATTGCTGGCGTCGTTAGCTCGAACGTTTTGCACACGAAATCTCCACCGATTTGCAGAACAGCAAACATAGCGAGCAC
CTCAGCCAGGATCAGCCGTGTCATCATTGATTCCTGCGCAACACAATGACCAAAATGGCGAATCCCAAAGCTTAGTGTGATGATAGTTATTCAGCCAAGA
CAAGTCAAGCCTTCAGACCTGATTCGATTTCGAGCGAGCGTCGAGAAAGCCACCGTCCGCCACAGCTAAAGCAACACCATTTGGGTGTCGTTCGCGCACC
ATGTTGCGGAAACTGTGAATGTTCTTTAATGAGTAGAGATTGCCTGTTCCATCCTCACCGTAGCAGACCTCAAACGATCCGTGAAGTTGAGACCGCACCC
GCCAGTCACAATTGTTCTTTGCACCCTTCAGAGTGATCCCAAAGCCGTGGACTCGTAGCATACTTTCAGCTTCACCCTCTGCATTCCCGCAAACATGTTC
TGCTCGCCAGAGCAGGTATTCAGAGAAGCCGCCTGGGCCACCGCAAATATCAGCAAAGGTGAATACATCTTTGCGTTGATGCAGGTTTTGCGTCCACTGA
AAGATGTGATCCAGTGTAACAAGCTTCATCGCGGACCGATTCAAAAACCGATGTCTACCCAGTGCCTCGAACACATTTGTTGCACCACGTGCCTGCACGA
ATCGCACGCTTTCCAGCGTTTCgaacttgcgcttctcgCGCTCAATGTCCTCCAGCAGTCCAGAGTATAACACGTCTCCTAGTTTCTCCCCCTTGTCTCG
TTCACTGCTACCCCCATGCATGGCAACCACAATCGCGTCGAAATCCTTGACGTCGCTCTTCCCATTGAGAAGATAAAGGACACCGTGCGAGCCAACCTCC
ATGCTCCCGGTCGAATACTCCGCAACCCGTCCTGCTAGCTCAGTCCCAGGGACCAATTGGGGCAGCGATGACGTTCCTGAGCTTACCACCCTGCCAACAC
GGCGGCGTGGCTTCCCAAACGTACCGAAGCCCATGGCTGccatcatctcctcctcctctccTCCTGCACCACTCATTTCGTTAATACTAGATACCGTCGA
AAAGTATAATTTTTCCTTCCAGCTAGCATGCACAAgaaagatgatgaagaggctGACATCGATACTATATTTTACCTATCTATCCACCGCAAACTCACTA
GCAAAATAAAactcgccagcagcagtacctAGCGAGGAAGGTCAGAAGCGCAAACGAGCAGAGCGAACATGCTCTCACACAAGTGCGTTTAATTGCCTCA
GGAATGCCCAGAACCATTTTCGCTGCCGCTATTCCCACCTGCCACagtgcagcagttggagtTTGTTCCATTGCTGGTTGCAGCggtgtttgtgctgctg
cgaaCGGCGCGGTGCAAAACAGAGTCCAGCTCCgcttcgagctgcaattcACGAGCAACACTCTCGCTCAGCAACTGCTCCAAATACTTGATACGGCTCT
GATCTGGCGCCATCTGCAATGCCTCACGAATGTTGCGTCCCTGTGCACGCTGGCGGGTACGCTCTTCGGCACCGTAGTGATACCGGTTCAGTACTCCCTC
ATTCAATACGAAGGAGTTCTCAGCGGACGACGAGCTGTCCGATTCTGAAGTCGCGGGTATTGTCATGTTCAATTCGTCTGGTGTAAGCGTCGAAGATCCG
TCATATCGCGCTGTTACAGATGGCGAGATTtcaaagtcgtcgtcgtcgctcatATCAGAGCAGTCCGACAGTGTTTTTGTCCGGAATTCGTCGAAGTCGT
GAATGACATCTATATCCAGCTCGACcttgttctcgtccagaTCACCGCCTATAGGCATCACTGATGGAGAATCCAGCACGCTGGTACCACGAGGACTCTC
ATCTCCATGCGAAGAAGAATCATCGTCTTGCTTCTCCACGGGGTCCATGTATTCCATGTAGTCCGGATGGCTTTCAGGGTCCCACCGGAAGAACATGCCA
TCCCACAGCACCACACGCTTCAGGTTAGCTCGGGGGTAAAGCACACGGTTTGTTGGACGGTACAGCGGGTTCTTGTACGGCCCAGGATTCTCCAGTACAG
GCGTCCAAACGGACTCCGTGCGCTCCCAAACCTTATCCAGCACACGCTCACGCTCTGAATTGTACAAGAACGTACCATACAAACCTGAGATGAGCGAATC
CGAGATATGGATCAAGAACTTCTCGTTGAACTCGAAGCATGTCGGAAACTGTCGCGTCATTTGCCATACACAGTCCAAGAATTGCAGCATAACTGGGGAC
CGCTCATTCGGCTGGTCTGTAATATCCTTGCCTACTCCGATACGATCTGCGAACTTGTGTCCAAATGAGCACCACTCCTTCTCCACTAGGCTAGCAAAGC
CGCGAATACTGCGGTAGAAAGGATCCAAGATAAGCTGTGCTAGGGCGACGAGCTGCGGTGTTCGATCCCAACCGTCACTGCAGTGCACCAGCACAGAGGC
ACCGTCTTCGTGAAGCACTTCTGCTACTCGTCTGGCTCCTGACAACACACGCATCACGTGTTTAAGCCAGCGAGTGTTCTCAAGTCGATTGTGGTAGTGC
TTGTCTCCatcttcgacgctgctgggACTGACCAAGGCCTTCAGCGCATCCACGGACTCTCGCATCTTGTGGATGTTCGCGATCCCCATGAATTCTATTG
TCGCGTTGTCATAATGCTGCGAATTTTCCACACCTTTGCCTTTTAACCTGTTCCCCTTTGTTGCAATGGGTTTCCGCGCGTCGATGATATGGAGAGGGGG
CGATACGTTAGAGCTATTCTTGTTAGCTGAATCGCGATACGCACGCAGAAGTATTCGATCCGGTTCGGATCGATTGCCTGCCATGCCATAGTTAGGTTGA
CTAGAACGAGACAGCACACTCTTATTCACAGGGTGGCGCCATACCACAACAGGTAGGCGTGCGCGTGAACGGAAGCGCGCTGACTGCACAAGCTGTTCCT
CCGACATGAGAGAAGGCACCACCATAAGCTGAGGATAAGTGGGACTGAAGCGGAACTTGGAGTTCTTTAAGAGACGCCACGTGATCacaccttcctcctc
cgcaTGCTTCTTCGCTGACAGAAAACCAAGACGCTGATATTCTGCAAAAGGAGAGTACACAAACCAGCCGTTGTGTTTCTCACTCAACGGCGTTGCACGC
TGCTTCACCTTTTCTGTGTGGTAGTCGAATGCAAACAGCGCACCAATCATGTTCGGAGGCTTCATGCGCAGTGTAAGCAAATTCAACCACCGGAAATCTG
GCGTTGATGGCAGTTGGTCGTATCCTTTTTTCCGAGAGTACGCATCATGCATGGCGAGACGCAACGTACGCAGGTCCTTGCACGTGATGAGTAGCATGAG
ACCATCCCGCGTGATGAGGTCTATGGCTGCAAGCGGTAGTTCGAAGGAGCCGAATTTCCACGACGCATCGTACGGAACAAACGTGATTCGGTATGACGTG
ATCTTTAGCACACCTTGCACAGCACGATCGCTCTGGGacatcaccaccagattGGTCACGCGCTGGACGTGTTCCAGCACCGATTCGCCTGGCAGTAACT
GGAAATGATCACTCACCATCGAGTCCCGCAGCTTGGATCGTGCAAAATCGCTGCTTACTGTAGAAGCCGTCTCATCAATCACTTCATTTTTAACCGGTGG
GGCCGTGGAAGGTTTCTTGTTGTACATGACCTTGCCCTGTTCCAGCGCCTGCACGAAGTTGGCTCGGTCTTCCGTGCTGTAAAACGTGATCTTTTTGTTC
ACGCTCGCATTTCCCGTCTGaatcttgagctgcatgcCCAGTCTCGACTGAGGCTTGGCTGTCACTGCAGCACAGCTGTACTCCTCCCGACTGTCATGTG
CCGACAAAAAGTAGAGCATTCGTTCCTCCAcatccacctgcagctgaaTACTCGCTCGCTTGCTGCcgagcttctccagcacacTGTCACTCTTCTTGAC
TGTAAATGTAAACAGCGTCACATCCGACAACGGCGCTGCATTGCGGTTAAAGCCAAACACATTGTTGCTGgatgtgtgtgtggaccgACTGCGTCCATGC
TCCATCATGAAGTTGGTAGAATCGCTGAGTGTATCGACGGTAGGGCGAGTACTACTGGACGTTGCAAAGTGTTGTCGGTCGtagaagctgttgctggggA
CCGTGTTCGTGTAGTTCCCCAACGAGCTCCTGCCGACAGCTACTTCTGGTCGAGGAATCTCCATGTTGTACCTGGGACTGGCTCTGGCTTCCATACTAAC
TGTGTCAATATCAGACGAGGTTTCTCTCGAACCAGAGGGGGCTGTGGCCGCCCACTTGTTCGCCCCACCGATGGGGCTGTGAGGGCCTGTGGACAGGAAC
TTGCCGCTCGAAACGTCGTCTCCAGCCTGTGTGGCAGtcttccttcttgtcgttctAACTCTGCGTGGACTACCTCCACTTTGGGAGCTCGAAAAGGTAG
AACCAGACCTCGGTGTGTGACGGGAAGAAGATGACTGGCTAGCTGAGAGATTCCCGGAGCCTTGAGAGGGCAGAGCAGGCGGAGAGTCAATTTCCTCGCT
CGGCAATTTGCCGATCAGTTTCCACACATTTGTAGTGGCTTGTCCAGCCTGTACGAGATTCTTCTCGGCCTTTAAGAGCTTGTCCAGCGTGGTGGAGTCC
ATCGTCGACTGTCGTTGTGCCAAGTAGGCCTCTTCCTGGTcgtctgttgctgtttccGTCGTGGCGGATGCTGGCATATCCCGAAGGCAGTAGGGCGTCC
AACAGGGAAG