Description :
From Genome Similarity Track
Location :
Scaffold_281:2560- 4132
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_281-abinit-gene-0.21Pantothenate kinase

Sequence
1572 bases(100 bases per row)
CGTCGGCCGTGGACCGCGTGCTGCTCACCAGCTCCTTCCTGGTCTTCTCCTCGTCCATCGCGCTGCTCTGCTTCCGCCGCAAGAGAGCGCGCCATCGCCT
CTGGCGTCAACGCGTCACGTTCAAGAAGATCTCCAAGCAGTACGTCTCGATGGTCGGTAGTAGGGTGCGAGTTCCTCTTTTACGGACGATACGACTGCTA
TAGGTCAGATGTGGGTCAATGCTTCGGCCTGGATATCGGCGGAACACTCGCCAAGATCGTCTTCTTTGAGAAGCGAGACGTGGGCTCAGGAGGGCAGCCA
TCTCCTGGTTGTTCCGTGCCACCTTCAGCAAGTGGGTCCAGTGGTGCAGGACCGGACCATCGCAAGCGACCGCGAGCGTCGTCACTCGAGGTGGCGACAG
GAGAAATGACCAAGTTCATTATGGAAAATGAACTGTTTGGTACAACCGGAGTTCAAGATGTGCGGCTTCGCGTGCATTCGAAGGCACTGCAGGGCGTACG
CACTGCTCATGCAGGTTATTCGGACCATGATGTTGAAGCTCATCACGTGTGGGGgTTgTAGGTGTTCCACTTTATCAACTTTGCGTCGAGTCATACGCGT
GAAGCCATCGAGTTCATCGCGTCACAAGGGCTGAACCAGTCGCTGCGATCCGTCCCGTGCACAGGAGGTGGTGCCCATAAAGTGAGTGAGCTAGCACCAT
ATTAAGCGAGACAGGGCACTGACCATGTCTGGTTCCATCATGTAGTATGAACCGATGTTCAGCGAGTTGGCAGGAaTCGAACTCGATAAGTATGACGAAA
TCGAGTGCACGATCCGCGgTCTCAATTTtCTTCTCACAACGCTCTCAGACGAAGTCTACACCTTTGAAGACgTGGACAGCAAGGCTATGGCTGCGTCTCG
AATGAAGGTGATCGAGTATGACGTGGACGAAGACATTTTCCCATATTTGGTACGCCAATCGCTCACCAGACCCTTTTGTATACTTGGCTAATGGAGTTGT
GATGCACCCATGCAGCTCGTGAGCATTGGTTCTGGTGTTAGCGTTCTTCATGTCAAAGGTCCGAACGATTACGAGCGCGTGAGTGGTTCCAGTATCGGCG
GTGGAACGTACTGGGGCTTGTGCCGTCTGCTCACGCAGTGCCGCTCATACGACGAAGCACTCGACATCTCGGTGAACGGTACCAACTACAACGTCGACAT
GACTGTTGGCGACATTTACGGCGGCTCGTACGAGAAGTTCAACTTGCCAGCTACAACGGTTGCGAGTAGCTTTGGTCGAATGATGACGCGTACGCGCGAA
GAAGTGTCGGATGCCGACGTGGCTCGCTCGCTGCTCATCATGGTGACCCAGAACATCGgACAAGTCGCCTTCTTGAATTCGTGTCTGTACAACACCAAAC
GCATCTTCTTTGTCGGCAACTTCTTGCGCCACAACAAGATCTCCGCACGCACTCTATCATACGCAATCAACTTCTGGTCAAAAGGAGCGATGCAGGCTCG
GTTCTGCAAGCACGAAGGCTACCTCGGAGCGCTAGGTGCGTTCATGAAGAATGCTGAAGTCAGAAACGCCCA