Description :
From Genome Similarity Track
Location :
Scaffold_1158:256- 3917
Sequence
3661 bases(100 bases per row)
CCGCCTCCGAGTTCTCGTGCGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCCGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAG
CTCGTCGACTCACGTCGTGTCCGGGTAGCCCTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGCCCACCCTTCGCGCACGTTCACT
ATCTTCTCGACCTCGAAGACGTCGTCCTCCAGCTCGCGCGTGACTTCCCAGCTATCCTCCGGCAAGAGCTCCACGTCGAAGTCGAAGCGCTCCTCGGTCG
GCACCGCCAGCTGCGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCCTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGCCGT
CTCGAGGCGCACTGCGAACGCGCTGACCAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGGGCGAGCTTCGCATACCCCGGCTTCACCCGATCCAGG
TACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACG
CTTGTGCCCTTGCCACCTTGTAGTGTCGCTGGATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGTGTCGCTTT
TTTCCAGGGTCGACCGAGGATCCCAGCCATGCACTAAGAAGAACGGGGTTTCGTTCCTCGTCCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTC
GGCGTATTCGTCCCAGTCCCGTTGGTCGACGTCCGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGG
GGACGATAAGCGAGCGTCGCTCGCTGTCTCTGACCCATGAGTTTGCTGAACGCCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAG
CCTCGCTCGCGCCGAAGCGCCTGAACACCGCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGTTGCATTCGCTTTGACCACGACAAACCCCGT
GAAGAGGTCGACGCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCG
ACGATGTTGCCCGGCGACTCGCCCTGGATGGTCGGCCGATCCTTTCCGGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAGATCC
CTGGTCAATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCCTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCG
AAGCGTCTCCGGGATCACCAGCTTCATCATCACATCCCGATCCTCGGCGGAATCGTCACTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCG
TACTGAGGCGCAAGCTTTTGGCAGTTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCTGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTT
CGTTCTGGGCGACGCGGATGCGGTCCAGGCGCAGTCGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCAGCAGCTT
CAGCCCCGGGGACTTGCAGTCCATCTCGTCCCGCATCTGCCTGATGACCAGGTTGGAGTCTCCGCACACGACGAGTCGGGTGACGTCGTCGAGTTCCTCT
AAAAGAGAACATCCGAGCAGCAGCCCGCGGTATTCCGCCTCGTTGACCGTGAGGTCCGTCGCATATCCCGACGCGGCGCGCATGATCTCCCAGTTCGGCA
GCTGCCAAATGACGGCACTGTATGCTCCGCCCTCTCACTTCGCCTTAGCCGATCCGTCGGAGCTCAAGACGTGCAAGACCTCGTCGCGCTCCACGTCGGG
GACTGGAATGACTACAATCCTGGACGCCCGTTTCCGGGGGGCGATCTCTTCTAGCGCTGCGTCGACGAAGGCTCGCGGTGTAATGCTCGCGTCCAGCGCG
CCGAGGAGTTCTTCTTCTCCCTTCATGGATCGGCAGACTTCCAGCTTCCACGGCGAGAGGATCGCGGCCCACTGTGACAGCCGCCCCTGTAGTCCTTTGG
ACCGGAACAACCAGGCGAGCGTCGTGGGACGTGTCAAGACGCGGACCGGTAGCATCGTGTAGCACTCGTTCAAGACGCGCAACAGGGCCAAGATCTCCTT
TTCGACGATGTCGTAGTTCAGCTCGTTGGGCTTCAGCGCACGGCTGGTGAACTTCACAGGCATGTACACTTCGTCGTGGACCTGCGTGAGCACCCCTGAG
ATGGCCCAGTCGCTGGCGTACACGATCACGACGGATTCTCGGTTCGCGTCGAAGGGCTTCAACATTGGGGTCTCGGCGAGTTTTGCCTTGAGCGCGTCGA
AGGCGCGCGTCGCGTGCGTCCACGTCTCATGTCCGTGGACTTCTGGACGCTTGGCGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACAGCGCGGTTGC
ATATACCGCAAAGTCTGCAATGAACCGGTGGTAGTAATTGAGGCTACCCAAGAACGATTACAGGCCCTTGAGCGTGCGCGGGAACTCGAGCGACGTCAGC
GACTCCAGATTCTTCGACTTCGCCTCGAGACCGAGTCCTGAGACTCGGTGGCCCAGGTAGTCGACCTTGGACATGCCCCACTCGCTCTTCTCGACACTGA
TGGACAAGTGCCGCTGCTCGCAGACATCCTGCAAGCGTTCGACCTTCTCGCACAGGTCGTCCCACGACGTACCCCCGATGAGGATGTCGTCGATGTACGA
CCTCCGTCCCAGAACGGAGTGAATACCTGGCTTCACCGGTTCGCCGTCTTCAAAGACGTCCTGAGTGCTGCCATCCGGGGACAGCTTCATGAACCCGTAG
AGCGCGTTGTCGATCAAGCGTTGGTAAATCTGCGGCGCGTTGCACAGGCCGAACGGCATACGCAGCCATTCGTACAGTCCCATCGGCGTGATGAAGGCTG
AGGTGAGCCGGGCCCGGTCTGTCATGGGGACGACCCAGAAGCCGCTCGCCATGTCGAGGGAGCAGTACCACGGATACTTGTCCAAGTCTTCGAGCAAGTC
GTGACGAGCGGCATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACGGCGACTTCGACTTCTGGATCATCCTCG
CGCTCAGCAGCCCTTTGATCAAGTCGGCGACCTTCTCTCGAAACAGCGGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGCGTCGCCCACGTCGAT
GTCGCAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGTAGCCGCGTTTCTTGT
CCCGTGGCTTCCTCGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGATCTTCACCTCGGCGGTCAGCGAGAGATCTGGCAGCACTGCCATCT
CAGACTCGAGATCCTCTACGAAGAGGCCGGACCCCTCGTGGATGAGGACCGCGTCTTCTTC