Description :
From Genome Similarity Track
Location :
Scaffold_1492:256- 3217
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1492-snap-gene-0.1Eukaryotic translation initiation factor 5B

Sequence
2961 bases(100 bases per row)
GCATGGCTGCGCAAAAGCCAGCGGGAATCAGTTCATTCAAGCGCGAGCACGCGCTCGGACCGCCCGGTGGGGTCGGAACAGAGACGTCGCGGCCGGCGAG
CGACGCCCGCGCCGACCTTAAACTACACACGACGACGCCCTCCGTCACCCTAGATGATGTCGAACACCTTCTTGAGCTTGATGACGAGCTGCCAGTCCTC
CTTCTGCAGGTCCTCGCGGAAGTTGTCCTTGAGCGCGTCGATGCTCTGGCGCGTGAGCCGCGACACGAGCTTGTTCTTGTGGTCAAAGTGGCGGCCGTAC
ATGACGCTGCCCTCGTTGTCGATGCGCACGGCGACCGACGCACCCTTCTTGGCGCGGTCCACCTCCTTGTGGTCGCGCTCGATCGAGCCCACCTTGCCCA
CGAGCAGGCCGCCCGCGGACGGCACCACGAGCGGCGTGCCGATCTTCAGGATGCCCTCCTCGACGTCCACGCCCAAAATGATCGGGTCCTTCTTGTTGAA
CACGCAGTTGGGCAGGATCTTGAGCACGCACGGGAACACGGCCACGTCCGCAAACTCCTCGCGGCGCGCCTGCCGGAAGTTGTCCATGTACGCCGTGAAC
TGGTCGAACAGGTGGTAGATAATGTCGGCCGTGAAGATGCGCACGCCCAGCTCCTGCGCCAGCTCGTGGGCGTCGTTGTGCACCTTGACGTCGAAGGCCA
GAATCGTCGCGAACTCGCGCTGGTGCTCCAGCTGGACCGACGCACGCATCACGTCCTTCTTGTGCACTGGGCCGATGTTCACGCACGACACCGGGATAGG
GGGCTCGCACGTGCGCAAGAACTCGAGCAGCGCCTCCAGCGCGCCGAGCGTAGACGCCTGCACCATCACGCCACGCTTGGTCGCCTTGACCGAGTCCAAA
ATGCCCGTCAGGTCCGACATGACCGAGTCCTTCAGCTCGTCCACGTCGTCGTCCGGGCCGACGACGCAGATCTGAGTGCCAGCGACGGCCTTCTCGAGTC
CGTTCGCGCAAATCTTGACACCCATAGCGGCCTTGATCGTCGGATGGTGGAGGTACTCGCCCTTCACGCGGATCTCCTTCATGGGGTGTGGGGTCAGCAG
CGACCGGATCGTTGTTACCACTGGACCTTCCAGTGTACACACGACGATCTGATCGCCTTCGTTGAGCCGGCCATTCACCAGCACCGTGTCGATCGTCGTG
CCCAGACCCTCGATCACCTTGACCTCCAGCACGGTACACTGCAGAATCTCCACGTACGCGAGCGACTTGGCCATGCGCTCCTGGGTGAGACGGGTCAGCA
TCATGAGCAGATCCGGAACACCCTCGCCTGAGATCGCACTGGTCGGAATCAGCGACACCGTGTTGCCCAGGTTCTTGTTGCGCCAGTAAATTTCGGCGTT
CAGACCCTGCTCGGAAAACTCCACCTGCACCTGCTTGGCGCGGTCCTCAAACTCGCGCAGCACGTGGTCGTTCTGGTACTTGAGCGCCTCCTGGACCGGC
ATGTCGGGCATCGTTTTCCACCCGTAGCAGCGATCGATCTTGTTGAGCGCGACCACGAACGGAGCCTTCTTCTGACGCAACAGGCGCAGCGACTCCAGCG
TCTGCGGCTCCAGACCGTGCATGATGTCAACCACCAAAATGGCGATGTCACACAACGACGAACCACGCGATCGCAAGTTTGTGAACGACTCGTGACCGGG
CGTGTCGATGACCAACAGACCCGGCAAACGGTACTCCAGATTCATGGTCTTCGCCAGCGCAGCCGTCTTCTGCTTGATCGCCTCCACAGGGAAGAACGTC
GCACCGATCTGCTGCGTGATACCGCCAGCTTCGGCGTCCTGGACCTTGGTCTTGCGAATGTTGTCCAGCAGCTTGGTCTTGCCCGTATCGACGTGGCCCA
TGATACAGCAGATTGGCGAGCGCAGGTTGTCGGTGGAAACGTTCTTGAGGGCCTCCTCCTCGCGCAGACGACGGCGCTCGGCAGCCTCCTTCTTCTTGCG
GTTGGCCTCCTGCTGCGCCTTGGACCGCAGACGCTCCTCCTCGGCCTCACGTCGGAGCTGCTCCTCCATTTCCTCCTGGCGCTTCTTGAGCGCGATGCCC
TGCTGACGAAGGCGCTCCTGCTCCTTCTTCTGCTCGAGCACCAGCAGATCTTCGTCGCCGTCGCTGTCGCCATCCTCGTCGTCGCGGCTCTCCTGGGGGA
CCTGCAGCTTGTCCTCCAGGGAGGCGACAAGGTCGCTCGACTCCCAGTCTTCATCGTCCCACGCGTCCGGTGCTTCCTCCTCCTCTTCCTGCTCATCCTT
GTCATCCTCGGCCTGCTCCCAGTCGTCGGCGACCTCCTCTTCCTTCTCCTCCTTCTTAGCAGGCTTGGGCGTTTCCTTCTTGGCCACGACCTCCTCCTTC
GGCTTCTGGTTCTTCTTCTTGTTGTTGCTGTACACCACCTTCTTCTTCTCCTCGTTCAAGGCGTCTGGCACCAGTCCAGCCTGCTGCATTGCCTCCAGAG
CGGCCTGGGCACGCGCAGCCTTCTGCTTCTGCGCCTTGGTCATGTACGTGCCCTCCTTCTTCTGGCGCTCGACCTTGGCGGCCTTGGCCTCCTTCTTCTT
GCGGCGGATCTCCTCCTGCTCCGCGAGCTCGGCCAGACGGCGCTCCTCCTCCTCCTTCTCGCGCTTCTCCTGCTCCAGCCGCTCCTGCTCGAGGCGCTCC
TGCTCCGCCTTCAACGCGGCCTGGCGCTCCACCAGCGCTCGGGCGGCTGCAGACACGGGCTTCTTGCTCTCGGTCTCGGCCTTCTTGTCCGCATCGGGCT
TCTTCTTGCCCTTCTTCTTCTTCTTGTTGTCCTTCTTCTCGCCCCCAGCCGCCGTGTCGACGCCGAGCNNNNNNNNNNGCCGCCGCCGCCGCGTCCACAT
CGTTCGCCTTGGCAGGCGTGTCCTTCTCGGCAGGAGTCTCGGCCGCAGCCGCAGCCGGAGC