Description :
From Genome Similarity Track
Location :
Scaffold_2746:256- 2727
Sequence
2471 bases(100 bases per row)
TCGGCTAGCTCGCCTGCCTTTAAGGCTTCGCCCAAACTCGGCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTGTCAAGGCTG
ATGTCGCCTTCTACCTCCCCCGTCACTCCGTTCACGAGTGTGTACAGCTGTTCACAGCAATCACGTGGAGCCTCACCGCTCATCACGTGGGACACATCGT
CCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCTTCTCCTCTCCCTCCGCGACCGAGCCCGGCCGGATGAGGGCGGTGTGGTGACATCTCCGTCACC
ACCACCGGGTGCAGCAGCACCATCACTCCTCGAAGAGGATACAGTGTCTCGCAAGACACTCGGCTGAAAGCCGAGAGGTCCTCGACCTTCACACAGTGAA
CTAGGTGTCACTTCACCTGCATCTTCTGGGCCACGCCCATGATGCCTCGACTCGCAGTCGACCGCGACCCTCGGGTCACGCAGCGGTAGGTCATCGACCA
GATTCGTACCACTCAGGTGGAATTCGAGCCACTCCGCGCTCGTCTTCACCGGACCCAGCATTTGGTCATCGACCCTGACCTGCACCGCTCAGCGAATAAC
GTGCCGCACCACGTACGCCCTCAGGGCAAAACAGCAACCTCGATGGTAACATATTCGGACATACCAATGTCCAGCACTACGACCGCCTCGACCTTCTGGC
TCGCGCCAAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACAAAGCTCCACTAGAAGCAGGGTGCGACGCACCCAGCGTTTTCGACTTCC
AGTCGATCCATGGCTAATGGCGTTCCAGCCAGGCCATGCCCAGGATGAGGACATACCTCGCATCCAGGTCTAAGACCAAACAGCGTTCCACGCTATCGAA
GCTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCGACACAGTTACCAGTGTCCCCGTCGCGAGACGGACAGCGATCGTATCTCTCGTTGGCACTTTC
AGCATACAGCTGACTCCCTTCTAGGGTGGAGCGACGGGCGTAGTTGCCCGAGGCTCCCGAGTCAAGCAAGACTCTCCATGGCTTTGCAAAGCCCTTCACG
TTCGCTTGAGCGACCAGCAAGCCCGGCTTGCACACACTCTTCTCGTACGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGCCCAATACCTCTTCGAG
GCACACCAGAAGTCAGTTCTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGCCTCGCGCTTCTTGCGCATAGGGCAATAAACTCTCAAGTGCTTAGT
GCTATTGCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCCTCTGG
ACCGCTCGAAAAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCACCGCCTCTTCAAAAGCG
TTGGGGTGTACACGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTTCGCCGCCA
TTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTCGACCGGATACGGTACGCCTGATT
AGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAGCTGATCCAAGTGGGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGC
GACCTCCAAGCCTGGAGATAGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCAGAGAAGGAG
ATTCTCTCCATCCTTCCCCTCGAAGGTTTTTTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGC
GCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAGATGA
GCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCGCGTCCTGCTGCGCCGGGGGCAAATTCTCGAACACGGGGTGTTCCATCCTCGCAGAGG
ATATAGTCAACCCGGCTCAAAAGCAGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAT
GAGTCACTAATATTAAGTTCCTTGTCCAAAGGAACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTT
TTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTGTTTAACCATCTAGCATAGTTAAAC