Description :
From Genome Similarity Track
Location :
Scaffold_3360:256- 2553
Sequence
2297 bases(100 bases per row)
TCGTCTAGTCGGTTCAGCGTAACCGAGATCCTGATGCTCGCCTCTCTCTCCCCACTTCAACACCCACATTGATTCCGTAAAGCGCCGCTGCCCAAAGCTA
TCTGCACTGGCAATTCCAATCTCGCTCGACATGCACCAACTCGTGAATCCATCCCACCCCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTACAGGA
CGAGGCCTGCAGTCAAATCTCACCTCGCACCTGTCTGATCACCAAAATTGAATCCCCACAAATCCCCAGCCTTTTCGGATCTTGTCCCTTTTAGTAAATC
CAAACCCCAGAAGGAGCCCGTTATACTCCGCTTCAGTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCA
CAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCTGCCTGTACCGTCGGGATCTGG
ATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTTGCGGCCAAGACTCCCAGGA
TCTCGTCTTCCCCTTTCGAACATTTCACAATCTTCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAA
CAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCT
TTCTCCACCGCCCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCCGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTG
AGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCTAC
GAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTACCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGT
GGATCCAGCTCCTGTGTTAGGTCCTCTTCTGACGTCATACCACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTCATCC
GGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTT
CAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTG
GAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTTCAGTAGGGATG
TCACTCTTTCGCACAACTGATCCCACGATTTTCGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAACACCGACGGAGTTCCAGGATCCGCTG
GCTCTCCTGCCTCAAATGGATCTACTTCCGTATGACCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGAT
CAGGCGTTGGTAGATCTGGGATGCGTTCTTCAATCCAAACGGCATCCGATTCCACTCGAACAGTCCAAACGTTGTGATGAATGCGGATATTGCGCGAGCT
CGATCCGTCATAGCCACCACCCAGAAACCACTGGCCATGTCAAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCGTTGATTAGAGGCA
TTGGATAAACCATCAATCGGGTCAGGCCGTTAACTAGCCGGTAATCGATGCACGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGTGACGCGA
AACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAATTATCGGATCTTATGAAGGGCCTGCTGCAAGCCAAGATCATCCGCTTCTC
AACATCCCCGTGGGCGTCTCCGGTGGTAATCATCATCAAGAAGAACGGTGTGGTAATGCATTTCCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCT
TCCGACGTAACCGATCCACTTCCGCGGGTTCGTTCGCACCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACTCCGGG