Description :
From Genome Similarity Track
Location :
Scaffold_82:256- 2070
Transcript NameFunction/comments
Phyag_g1734hypothetical protein PHYSODRAFT_534742

Sequence
1814 bases(100 bases per row)
GAATTCTCTCCGTGGTTAGGCTGAAAATGCACTTTCTCAGCGCCCACGCGACACTTGTTTGGTCCCGACTATGGAAAATAATAATGCAGAGCGTCGACCT
TCCTCACTCTCACTCAATGGAGGCCGCGGCtgaacctcctcctcctccttcttcacgcggcggcggctggCTGGCACGACGGCGTGCGTCCCGACTGGAC
AGCGGAGGCGTGAGCAGTCCTCCTCTAACGGCACTggccgcgctgctgctcagtACGCAGCCACGCGCCACGATGACAGACACGCGCGTACTCGCCATCT
CCCGCGGGACGTCcgtgggcgacgacgacgagcacgaagagGCCTCGCCCAACGTGTACAAGTTCGACGTGGCGCAGTACAAAGACGGCTCCTTCCGCTT
CGTGCCGGCCTGCGCGCGCGACCTCATCAAGTACACAGGTAGACTGCTGCACCATGGGGCGCAGGCTGCGCGCAAGACCAAGATCAACACAGTGCAATTC
GATTGGCCCGCGGTGGCCTTCCAGATCTCCGTACgaggcaccagcagcgtcgccattcGACTCAAAGGAGACGGTAAGCTGTTATTTTGATCCATTATTG
TTGACAATGGAGCACATGTGGGGGTGATTGGCGATTGTTGATTGGCATCAAGATCTCTTTGAGTTAGTCGAGCTTTGAGTTAACACTACTTCTTGAACGG
AGTCAAGTGGCCGGTTCAACCCACGCTCTGAACTGAACTCATTTTGGTCCGACGCCAAGATCCGATCGCTCCGACCAGATGTTGCTGCGGTTTTTGTTTG
ATTGTGGTCCGTTAGTTGTCGCTGACGGTGGTTCTGGCGCCAGGGAACTACTTCAATGTATTTGTGAACGAAGAACTGCGCTGCATTCTCCGTGCGTCGC
TCAATGCAACGTGCTGCGATGGTCAGAGAATGTGTTTTTAGTTTTTGATTGGTGAGGATTGCTAACGGAATTtatttggtgctgttgcagtggcgacgGG
CTTGAACACCGACCAGGAGTACAGGATCCGAATTTGCAAACGGACGGAGCCGCAGATGCGAGGCGCGATGTCGACGTTCAAGGTGAGAATTGTCGCCTGA
TACGTTGGGGAATTGAAGCGTGGAGTAACTAAGATTACGGTTGTTACGAATGAATTCGGCGATAGGTGTGCACATTCTACGGGTTTATTGTCGAGGAAAA
TACAGAGGTTCTCCCGGTTGATCAACCAGAGCCGCAGCCGGTTCGCAAAATGGAGTTCATCGGCGACTCGGACACGTGCGGTTTCGGCAACGAGGGCAAA
GCTAGCAGTGCCAAGAACTTGTTTGGTATGAAAGGGCGTATGGAGAACGTCTACAACGGATACGCGTGTATTACAGCGCGAATgtttgatgctgaagaac
atGTGCTAGCGTGGAGCGGGTAAGCCCTTcatatttttttttgctttcATCGTGAATCCGTAGCGCTAACATTATTGTGGGTTTTGTGAAGTAAGGGCGT
GCACAGCAACTCTGCGGATTGGGGGCCGAACATGCCCGCCTTGTGGAAGAATACACTAGCATCTCGGCCTGGTGACTGGGAAATGTCCAGCTGGATACCT
GACGTCGTGGTGATCAACCTCGGCATCAACGATTTATCACCTCCTGCGTCAGCAGAGACAGACATTATTACGGGCTACGCGGCGTTTTTACTGGAAGTAC
GCTCCTGTACGTCTTGCATACTACTGACTTGTAAAGTATGTGTTGATGAGCTCAACTAACCTTTTATTTTGCGCACCCCAGACCGCCCAGACGCCCACAT
TTTTTCCGTGGTAT