Description :
From Genome Similarity Track
Location :
Scaffold_66:255985- 263792
Transcript NameFunction/comments
Phyra_71984NADPH:adrenodoxin oxidoreductase, putative
Phyra_82016myosin XI
Phyra_82017LOC100284927

Sequence
7807 bases(100 bases per row)
ACCGACGTCAGCGCCTCACATCCAACATGGCGTCCAAGCTGCTGCGTCGTCCGCTGCTTGCTCGCTCCTCCTTGGCGCGCAGTTTCAGCGCCGCCACCAC
CGACCAGCAGCGTCGCGTGTGCGTGGTGGGCTCGGGTCCTGCTGGCTTCTACGCCACGAAATACCTGCTCAAGGAGCACTCCGGCGCGCGCGTGGACATG
CTGGAGGCGCTGCCCACGCCTTTCGGTCTCGTGCGCTCGGGGGTGGCGCCCGACCACCCGGAGGTCAAGAGTGTCATGAACGACTTCGACAAGGTGGCGG
CCGACGAGCGCTTCCGCTTCCTGGGCAACGTGCGTGTGGGCGAGGACGTGACGCTCGCCGAGCTGCAGCAGCACTACCACGCCGTGGTGCTGGCCTACGG
CGCCGCCGGGGACCGCGAGCTCGGCGTCCAGGGGGAGCACCTGCATGGTGTCATGTCGGCGCGCTCGTTCGTCAACTGGTACAACGGCCACCCGGCCTTC
CGCGACCTGCAGCTGGACCTGCAGCACGCGGAGACGGCGGTGGTCGTTGGCCAGGGCAACGTGGCCGTGGACTGCGCGCGCATTCTATCCAAGAACGCTG
ACGAGCTGGCGACGACGGACATCGCCACGCACGCCGTGGAGGCGCTGCGCAACAGTGGCGTCAAGAAGGTCTTCCTGGTGGGGCGGCGCGGCAGTGCGCA
GGCGGCGTTCACGATGAAGGAGATCAGAGAGCTGACCAAGCTGGACGGCGTGGCATGTATCGTGGACCCGGAAGATCTGAAGCGCAGCATGACGCCCAAC
TCAGAACAGGAGATCAAGGAGCAGCGCGCTCGAAAGCGCATGAGTGATTTGCTCGGCAAGGCGGCGGAGCGATTCGCCGGCACCATCGACGCTGAACGCG
TTGTGCAGATCAAGTTCTTGAGTTCGCCTGCAGAGATTTTGGCGGATGAGAAGGACCCGACTCGAGTGGGAGCGATTCGCGTGGAGAAGACGAAGCTGGA
GGGCGAGCCGAACCAGCAGCGTGCGGTTGGGACTGGGGAGTTTGAGGACATTCCGTGCAACCTCGTGCTTCGCAGTATCGGCTACAAGTCGCTGCCCATC
GAGGTCAACGTACCCTTCGATGACCGACGCCATGTAGTCTCGAATGAGCAAGGACGTGTTGTCGCAACGTCCGTTAGCGGTGAAAAGCAGCCCGTTGTGG
GCCTGTACTGCACTGGTTGGGTGAAGCGTGGCCCCTCTGGTATTATCGGCACCAACATTTTGGACGCACGGGAGACAGTAAGCTGCATCGTCGAAGATTT
TGCAGCAGGCAACTTTCTTCACAGCGATAAAAGCTATGGCGAGGACTTGGGTGGATTGGAGACCGTGGAGAAGCTCATCAAAAAGCGTAACCCAGAGAAG
CAGCTAGTTAGGTGGGCTGACTACGAGCGTCTCAGTGCCGAGGAAAGCCGCCGCGGCGAACTTCTCGGAAAGCCGCGTGAAAAGGTCACGTCTGTGGCGG
AGATGCTGTCGATTGCAAAAAGTATGTGACTAGCTGCTAAGAAAACCCAAAGATGATCTGCGGCAAATACTGAGTAGCGGTGCGCAAACAAACCTAGAGA
ATCGATTTTTATCGATGGTAAAACGTCACTTCTTGGAGCCATTGCGCTCTTTTTGGCGAGTAAGTGCAGCATTCGAGGCTTTCAGTGCGCGAGTCTTCTT
GCGCTGCAATACCACCACAAGTCAATTGAGATTGAACCCGTCAGCTCGCGTCCTCATGAGACTGTAAGCAAGGCGTACCTCTTCTTCTAGCAGCCTCATC
AGACGCCTGCACTCCGCTGCACCTTCAACCGTGTCGTCCTCGTCCTCGTACTGATTCATCACCCTAGATCGAGCCTGAGTTGCGCCATGTCGCTCTTCAT
GTGCGTCTTGTTCATTTGCGTCGAAAGCAAAGGTGTTAATGAAAGGCTGGTTCACTCGATCACGCAGAGTTGCCGCGTAGGTTGGTTTAGTTCTTCGAAC
GGGGGCGGAAACTGGCCGTGATAGTTTGCTTGCCGAAGATGCCAAAGTGGCAGAACGTGGGTGTTGCAAAGGAAGTCGTGCTGCTGCTGTCGCCATCTAT
TCGCACGACGATGCATTCGGTTAAACGTGCTGCTAACATCGGCAACGATGCAAAACATTCTGCTCGTACGATGGCTTTCACATGCCGCAGCTTCGCAGGA
TCCGCCAGAATATTTGTTGGCAATGAAAAGGCTCTGGGATAGCATCACCGAGGTTAGCTGCGCCGTACAGCAGTATCATAAGGAAGATAAACTTGAGTGG
CGTTTCGCCGCTGCTCGTACCGCTGGCTTGTGTCCACAGCGCTTATGAGCCGCCCAACATACGTGTACATCTCCAAGCAGTCCTCGCGGATATTCTACGA
TAGAACAGTGAGGCATCAGAGGATGGTTTTTAGCAAGCTACAGCACCAACACTTTACGTACATCCATAGTATCAGTAGTGGACTGCTGTAGCTGTGATAA
TTTGCTGTTTGTAGTGTTGAGCTCCTCTGTTTTGCTTTTCAAAGACTGCTCATACTGTTGAGTGCACAACATTTGTCAACAACTTCTGATGCAACGCAGC
TTCTGTCCAACGTACCTGCTGGCGAATGAGAGCGATTTCATTCTCTTTCAACTTTTGCAACGCAGCTACTCGTTGGCGTAATTTCTGAGTGAGAAGGGCA
TGACATATATATTCGTGAGTTGACCGAGAGCATGGAGCAACGCAAACAAAGCCTGGCCAACCTGGTCGAACTGCTTTTCTGAGGAATCGGAAGTATCCAC
GTGTGGATTGATGTTTGAGGCTTGATGCTGATGATAGGGAAGCTCGTTATCCACGCTGGCGCGCATCTGGTTGTTTCGGCTGAGGAGCTCCATCATTTCT
GCTCGGTGCCGGGCGGCCTCTGACGCCAAAGCGCGCTCATACTCACACGACTTTTGCTTCAAACAACTTTCTAATGTAGCAATCCTCCGCTTCTGCTCGT
TGACGACATGTCGTGCATTCTCTTTGTCTTTCTTTGCTTCAGTCTGGAGATAGTAAGATTACGGTCGTCAGCGAATTGGAGATCAAGTTGCCGAAGATAG
CCATTCCTCAACTCACCACGACCACAGTGAAATTACTCTTTGCATTGGTGTACTTCTGTCGTAATCGATCCCGATCGGTCCTAGCATTCTCTGCTGTTGC
GTGATTCAAAAGTAAAATGACGGGTGTAAAGATTCATAAAATTTGTTCTACGATACCCAAACAACTCACCGTTGGTTCTCAATAAACCTTGGACGTGCCC
TGCAGGCCCAGTGTGCCTGTTCTTAAGACATGAGCTTGAGGTTACTGTACGGTCCCCTTGGTCTTCATCCGAAAACACTGACTTCAGCACGAGTCCGTCC
TACGTTCACACACACATAGCAGAACTGCTGGGTCAAACCAAATATTCAACCAGTTAGATATGTGCGACCTACTGCAAATTTGATTTCGCCGTTTTCCGAG
ATCTCTTCAGCCTGGAAGCCGAGTTCGTTCAGTGTGGAAACAAACTTATTGTTGTATTCCGTGCGCAAACCCTCAAGCTGACGGCGCAAGACGCTCAGCT
CTTCTTGAAGCTTACGGATACGCCGATCCTTGTCCACAATTGTACCATTTATATGATTTACACGGGGCTACGCAAATGCAACCACCAGGTTAGTCGCAGC
AAATGAAGAAGTACGTTTTGCATTTACTTACCTGGTTCTGCACGGAACGGCACCGGTTGGCAAACTGGAGGGTTCCCAGGCATTCTTCATAGTGCTCCTT
CATCGGATGGATAGTTGCAATAAGTGTGGTAAAACAATTTCCTCCTGCAGCCAAAAGTACAAAGCAAAGGCAAGTTAATTAAGCAATGCAATCAAGGAGT
AAATTTGCTTCATGCACGAACCGATGCTGTTCTGTAGAAGTCGCGTTAGTTTCGAGTCCCGATAGGGGATGTAGTTATAGCCGCTCTCTGGATCTAGTGA
CATCACAACTTTGCCCACGGCACTCAAGCTCGAGTTAATATGCAATGCCTCCTTGAGGCGCTGGCCATCCGACTCGCTCTTTTTCAGGCGCTCAGACCTA
GCACCACAAGAGCACCGATGTCAGAAACGCAAACAGTTGCTGGGGGCTGCTTCAAAAGGACAAGTATGCACCCTGCTAGATCCACCATGTTGAGCATTCC
GTATATCACTTCCTCGGTGTCTCGAACTTTACCCACGCCATAGAACCCAAACAAAATCAAATTCAGGTTCTGTCAGATAGCAAGCAAGTTTGTCTGCATC
ACCTTGTTGAAAGACGTGGATGGTAAATACCGTGTGCGAGCGCGACGACACGGCATTCATTTTTGTTTCGTGCGTTGACCGTAGTTTCAGACCGCATTGT
ACAATGGCGTCCACTTCTTCCCGTGAGGTTACGGTGACCATCGATAGGTCCTTCACAAAAACTCTGCCTTGAGCATCCTCGTGAATCTCGTAGTTCGCTA
GGACAGGAAAAACGCAACAAGTCCAGGAAGGCGAGTTAGTTCATGAGTCGTGGTGGAGATCTTCAAGCCGCATTTGACATCAAACGCTGGCCCTCCCAAC
CTTTTTCGTAATCGTCGTCGTCTTCCGCTTTTGGTGGGTTCGAGCTAAAGCTTTTTCACAAGCACAGAATGAGTGAGTGATTCGATTGCGTATGTTGCAC
GTGTTGATACAAGCATACCTAGCAGCGCTCTCTGTTCGAGGGATCTGCTGCTGTTGCTGCTTGTACAAGGTTGCACCACGGTGAACCTGTCAGCAACGCG
CCAATACGTGCGAGGGATACTTTCACTTACTTGACGAAGAAACCATTCAGCGCTACTTGACGTCTGGTATGACACCGGCCGACCTGCTTTCTTCAGATAG
CTAGAGTTCTTGTCAGTTGATAAGCAAACTAGAAATTGAGCTTCAATTATCACGGCACTCACGCTCGAGCGAGGTCACGGACGCGATCGCAGTAGATTTC
CAAGAAACTAACCACGAGCGTCACTTCCTGTTCAGTAAGCGTCAACACCACCAGTAAATAACAGCCAATGTTCGCATGAAATTCCACGTACCTTGGATTT
ATTGGGTTGACGATTAACCATGTCGAAGAGGTATTCAATAGATCGTGATAATAGCCCCGCCTTCTCTCCTCCCGGTTCACCAAAGATACTGCAGATGCAC
AGAAGAAAGCACCAACCATACCATGTTATTCTTTCACTCATCGCGATGGCGATACACACGTTGTGATGCTATACCTGAAGGTTTTACCGGAGCCTGTTTG
ACCATAGGCAAAACAACAACTGTTGATGCCTTTCAGTGCGAAGTCCACTAGAGGTTTGCTCGTCTACATTCATAGATCCAGACGCTCAATCCTTGTCAGC
CTGTAGATAAGTAAAATTGTGTATACAGCACACTCAGGATATACCGCTTCAAACAATGTTTCTTGAGTTGTGTCGGTCCAATAGATCTACAACCAACAGA
TTTTGGTTTTAGTGCATCGGCTGGGAGTTCTCGTCACAGAAGTTTAGGTTTTACATTGTCGAAGCTAAACGCATGGTTTCCGTATTGCATCCGTTCTGTA
TCCTAAGCAGCACCAAATAATCAGGCGTGAACTCAATACCGTGTAAAAGACCACCACCCTGTATGTTTCCGCACCTTGATCACGATATTGCTTGGAGTCT
CCTTCTTCCGCTCGAACATGTCTTCGGGGGCACTTTGGCCGTCAGCACAGGGTCTTGCGCGAACATACACCTGCAATGAAAGCACGAGCAGACGATGGAT
CCGTGGAGCTCAACAGCACACTAAATACTCTGCATGTAGAAAGCTATATCCAACCTTGACGTTCGCATTCCCGAGCAACCGAGTGTAGTCGGTAGTGACC
TTGTGGTCCATGACAATAACTTCTGTGCTCTCTTGGTCTAGATAACGACGAGCAGAGCTTTAAGATCGTTGCTTGGATGCCTCCACGGGGGTATTTTCAG
TTCGCGTTTCGCTCGACTTGCCGGCGCCTCTTCATTAGAAAGCTGCAACGCTATCGCAATGGGGGTCACCACCAACAGTACCGCGCCGAATAGCTCGGTC
GAACATCTGCACAATGTTCTCGCGTATATCCAACAGCTCAGTGCTCAAGCTGCCGACGGGGGCAGAGCTAACAAGCACCAACAGATTCGAGTCACGCATT
GGGCGCGGAAGCTCCGCAGCCAGCCCACGTCAAACCCTACGTGGTTGAAAAGTGTGCTGGAACATGCTAATGTGCTGCTTCAAATGCTGCTAGAGGGCGT
ACGTGTGTGTCATCTTGGATGTAGTAATAACGTTACATGTAGATGCCAAGATGATGCTAACACAGAGCGGTCTTAGGCGGTCGAGGAGCCTTTCACGAAA
ATGCCGCCCCAAGGGCCATTAGCTGCACTTCCAAGGTGCCAGGTGAGACTCCGTGACGATTCCCTGTTTAATCCACACAACACATTCATTACCTACTTTG
ACCAGGTTGCACGTCTCGCAAAGGCAGCAGCGCATTTCATCAGATTGCCAACAGACCGCACTCGAGCAGTACCGATTGGGGTGCAACTCAAGCCACCAAG
ACAAACAACACACAGTAACAATGCAGATGAGAGCGTACAAACTGTAGCTGATGTTCGGAAGGTAAGTCAGCAGGTCCAAACCCAAGAAGAAGACGATCAG
TGGGAATGGCAGCGCGTCTGGAAAGGTGCTTTCGACAAGATGCGCCAGCAGCTACAGCAGATGACAGAGGAGACCGAGGCACTAGCCACCGAGAACAAGG
TGCGGTATCGTACTCCAATGTGAAGGCTTCTATCCCTTTTTGATTCAAAACTACCGGTACGCAGGAGCTGCGTGCTCTCGTGGCAGGCTGCGAGAAAGCT
CTGCAGGAAGCCGATCGGACTCAGCGCGACGTTGTGGCCAAGCACGTCGCCGAGCTGGACAACCTGCGCGCTGTCCACTCCTTGGAGCTATCGGATCTAC
AAGCTCGACACCGGCAGAAATTGCAGCAAGTGACTCTGCAGAACGACGAGAAGTTGCTCAGCAGACGACAAAGTCGCTTCATCCAGCCAACACCGAACAG
CAGCAACTCTCCGGTGCGTACGCAACTTGTATATTATCTAGTACTCGTCTTACCGTTATGTCGTTGCTATAATGCTCAGCCCGACGCCAACGCAGACTTC
TTGCAGTACATCGACGCCTTCTACTCGGCCACTTTGCACCTCACGGCGCAGAACAAGGCCTGACAATTGACCAGCATACGTGGCAGTCACTTATACTTGG
ATGAAGTATACATAAATCCGCAATTAGCACATCCCGTCACTTTGCGATAGAGACTAGAGACCTCATGTCGACCAAAATGCTGCAGGGAGACCCGCGACGT
CCGGGCGACTTGCACCCGTTCGTGCGCGAGCAGGTGGACCCCGACGACGCCCCAGGCGACTGGTACGCCTTCTTCTCGCTCGTGCTGGGCTTCCTCGCGT
TCACCATGAAGGTGCGTCACAATCCCGCCCAACTTGCTTTTGGGAGTCTTATTTGGGCTAATATTTGTGTACCTTTTTCCAGTGGAAGGAGCTGGCGTGG
GGTTCGCTGCTGCTGTGTGTGGGCTCATTCACCAACATGAAGTCGCAGGACATGAACACGACGCAGGTGGCCATGTCCTTCTTCTTCTCCACGAGCGCCC
TCGTGTCCGCCTACATGGGCAATATGCGTCCAGGAATGCCCATGTCGTCGGCCCAGACGGCGGATGCCCCCGCTTCGTAGAAAGAGGGAGATGTAGGTAT
CCATCAG