Description :
From Genome Similarity Track
Location :
Scaffold_33:255963- 256988
Transcript NameFunction/comments
Phyci_308577Hypothetical protein

Sequence
1025 bases(100 bases per row)
GCCTTCATTTGAAGCGATTCGAGGAGCTGCAGCTCAAAAGGTGTGCTTACACAGCAGTATAAACAACTTTCTGCAATCAATGTAATAATTCCGTTGGGTC
TCCATGAACTCGGCGCCTGGTGGATCTTGAGGCTCTGCTCGAACAACAACGAAAACCAACAACTCCAACAAATCAAAACCGTTGCGCGTTGGTTAGCAAG
ACTGTGCAACGTAAATACGGGATGAATCATGGCATTCTCAACGCTCCAGCTCTTCCGCAGAGCATTTTGTCATTTAACGATCTACCTAATATGAGCCTTA
TACGGTCAGGTCCTCGATTCCCGAGGAGCTACAGCGCTCGATGCGGGTGATGTCCCAATCTCGGTCATCCGTCGGTGAAAATGAGTTCACCGCTGCAAGC
GTCTCGGGAGAGAACATGTTGGGGGCGGTAGGTGACACGGCCGGTGAGCCATCTGAAAGCAGAACACCACGACTAGCATCCACCTCGAGATTGTGCTGCG
GATGCTTACTCACAAGCTTGTCCATGGCCTGCCGCATCAGGCGGATGGCGGCCTCCTTTGTTGGGTCATTTGAACCGCGCTCTTGCAAAATACGAAGCAC
GTTTTCATGGCTCTGGATGGAAATTAGCAGCGCTTCAGAGAACGACGCCATGTCGATATCTCCCAGGTCCAAGTCTTCAGCAGGAGTCGCGACAAAGTTG
GCCAGATATACATCGTGCAACACGAGCACGTCTGTTAGCTCCGGGTACTGGTACCGGTATGAATCGGCGGCCACAAAGTGCTCCGGGTCCCAGCGCGGCC
ACTTCTTCGCTGCAGCTGCTGTTTTCACCTTCGTGAGCTCTGCACTGATGCATTTATGAAGCCGCTGTCTCATACTGACTGTCCATATTAGTGTTGCAGT
GCTAATATCTTCAGTGGTTTGGAGTTCCAAAATGAATTGATCCGGAGAAGTCCGCAGAACCTACAGCACGTAAAAAACACGTAAGAGATACCTGTCAGCA
TAACGACTTGACACAGCCCTTGCGA