Description :
From Genome Similarity Track
Location :
Scaffold_145:255962- 259415
Sequence
3453 bases(100 bases per row)
ATACGCCGGTCCTGACAGCGAGTGGGAGCTTTGGCACGCTCGCATGGGTCACCTCAACAAGGACGCGCTGACGAAGACTCAACGTTCCACAATTGGTATC
CCACATGTGAAAAATGGGAACGAGACTTTGTGCGGTGGATGTATGAAGGGAAAGAAGACCGTGACGACGTTCCCGTCACGATCGCTAACGAGAACGACGC
GTGTGTTGGAACTAGTACACACGGACGTAATGGGCCCAATGAGAACGATCTCAAAGGGTGGTGCCAAATATGTTCTGACGTTCGTAGACGACTACTCAAG
GTTTGTCGTTGCGTACTTTATGAAGAGCAAGAGCGAGGTGGGCAGCAAACTGAAGGAGTTCAAGGCATTGTACGAAACCCAGTGGGGGGAACGTCTAAAA
TGTCTTCGTTCCGATAATGGAACGGAGTTCGTGAACAAGACAGTTTTGGAACTATGCAAACGGAACGGTATCGTGCATCAGCGTAGCGTTCCATACAGCC
CTCAGCAGAATGGAGTGGCGGAACGCATGAACCGTACCATCATGGAGAAGGCAAGAAGCATGCTGCACTACAAGTCTATGTCGACGCAGTGGTGGGCGGA
AGCGGTTAGTACTGCAGTGTATCTCATCAACCGTTCCACGAACACATCAAACTCTGATGTCACGCCGTACGAGCTGTCGTTCCAGGTGAAGCCACGGATG
GAACACCTACGTGTTTTTGGGTCACAAGGGTACGCTCATGTGGACGACGTGATGAGAACGAAGCTGGAACCCAAGAGCTTCAAGTGCACGTTCCTCGGGT
ACGCTGAGAACGTGAAAGGATATCGTGTGTACGACATGGATGCGTCGAAGGTCAAGGTGACACGGTCGGTCAAGCTGGACGAGCGTGAGGTGGGCGGAAT
CTATGACACGCAGTCGCCAGCTTCAGGAACGGTCATCCATGTGACGAGGAACGATGATACGATCGTTCCAATATCGGGAGTGGAACGTAAGCCTGCTCAG
GATGAACCGATGGAAGAAGCAGAGGAGCCTGCTCAAGACATTGAGATGGACGACCTTGAACCGGAACGGAGCGCAGAAATACAGCAGCTACCCGCGCCGG
AGGAGCCCAGGTTAAATGGGTTGGATTTGGCAACGTTCCATTCGCAGCCTCCATCGTTCCATGAGGACCGGATGATCTTCCATCCTGAAACGGAACGATC
TACGCGCCCTCGTGAGCCATTACTTCTACTTGGGAATGGTGACGATGAAGACGTGGAACGTGGAAGTGATGGACCGTCATCTCCTAAGCGTGCCAGAATC
GACGAAGATGGTTTGCTCGCAGAGGCAGTGTTGGCGTACGCGGCCAACATTGGTGGCGTTCCAGATACGCCTAACACGTACGCAGAAGCTATTGCCAGTA
ACGAAGCAGGAGAGTGGCGTCGTGCTATGCAGTCAGAGCTGAACTCGCATTCCCGGAACGGAACATGGACGCTCGTTCCACGTGGAACGACAACTCGTTC
CATTGGATGTCGCTGGGTGTTCACGAAGAAGCGTGACGAGAACGGCCGGGTTATCCGTTACAAGGCACGCCTAGTAGCGCAGGGGTTCAAGCAGAAGTTT
GGAATAGACTTCTTTGAGACGTACTCCCCAGTTGCGAATATGAACTCGATTCGAGTTGTACTCGCTGTTTGCGTTACGTGCGGCTACATTATGGAGCAAC
TGGATGCCGACACAGCGTTCCTAAACAGTTGTTTGGTGGATTTGGTCTACATGGACGTTCCATTTGGCCTCGAGAATGCTGAAGGCATGAAGTGCAAGCT
GCTAAAGGCCATCTACGGCTTGAAGCAAGCTGCAAGTGCATGGAACAAGACTATTCATCGCGTGTTCCTGCAGAATGGTTTCAAATGTTGCGGAGCCGAC
CAGTGTGTCTACGTCAAGCGTTCCAAAAACGCATTCGTGTACGTATGTCTATATGTGGACGACATGATCATTGCGGCCAAGACGCGCGACGAAATTCGGG
AGGTCAAAAACGCCCTGAAGAGCGCATTCAAGATGAAGGAGCTTGGCGAGGCCAAATTCATTTTGGGAATGGAGATTGACCACGATAGAGAATGTGGAAC
GTTGATGATCAAGCAAACTCGGTACATTGACGACATTGTGGAACGATTCAATCAACGGAACGCCAAGATGGTGGAGAACCCTTGTGCAGCAAGCCTGAAG
TTATCCAAGATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTCGAGAGAATTTGGAACGTTCCACAATCAAGGTGCCCTTCATCGTCACGAAGCAGCAGTTAGTTTAC
ATGCTTACGAAAGCACTGGGATCGAAGTCGCTAGCGTTCCTTCCCGCAGCAAGTGGAATCAAGAAGAGGAACGACGTGCAGTAGCGGTGAGTGGGAGTGT
TGATATGCACCGACTCTGCACGGTTCGGCTAACCGGTGTGACGTTCCAAAATGGACCGGTCCCAAACCGGTTAATCTGGTGGATGGCCAGGAGCACTGAA
GTTTAGAGGACAGATTTAATTGACTTTAATCTACTCACTTCGGCATTTGGCCTTCACACTACACACGATCATTTCGACTAAAGAATCCTACTACGTAGTA
CTAAAGTAGTAGTTCTAGGTTCCTATTAATAAAATCATATTTGTATTTCACCTACGCGCATTCGTCCATGTTATGTTGCATGACGCGGCGATTTTGCTCG
ACGTTGCTGAGAAAATACCCTAATGCTTATGTCATTGGCGGTGCCTGCTGTCACACCTGATAAACCGCCTGACATATTAATTGAACAATATAAGCATCTG
TACGTGAGGGATGTAACAGAATTATAAAAAAATGAATTTTATTGAATGAACGTTTGCCCGTCTAGTAAAAAATATAGAGTACGAGCGAATCGCGCCTACT
TTATCTTATCAGCATTTCTTAAATTGTCGCGTTAAAAACCGAAACCTCCGCGGATGTAGCGACCTGGTTTGGGTCTGGGTTTTAAGCGTCCCCCTCAACT
CAATTTACTAGTCATCGTCTTCATCAACCAAACTATCTACTACATCACCGCCG