Description :
From Genome Similarity Track
Location :
contig_187:25596- 27197
Transcript NameFunction/comments
g14139.t1hypothetical protein

Sequence
1601 bases(100 bases per row)
GTACACTCCGCGACAAGATAAATCACCCACCCTCGTTTGAGGGCACAGCTCTGTCAATATTACGAGTTAGCTATTGCTGTTTAGATATGCTGCTTCTGTC
ACCAATAGACCAACGTGGTTTGTGCTAACGATTGCAATTTCGCAGCGTGCGGGGGACCTCCAATACAAAATTCCATTTAAGCATAGCGACACATTAGATC
ACCCACTCGAAGCGTACAAAAATCAAGTATAAAATAATGACGGTAATTTCAATAGTGCGTCTTATTGCCTTTCTTATCTAAGACTTCGATGCATCTGCGT
GGCATGGACTCAATGAGTGACATCAGCAGTGCATGAGGAATGGATTCCCAAGCCTCAAACAATGCAGCCTTCAATTGAGGCACCCTATCAAATTGTCTTC
CATTTGCATACACTCGCCTACTCATAATGGACCACAAATTCTCAATAGGATTGAGATCTGGGGATCTTGATGGCCAGTCGAGCAAGCGAATATCTTGCTC
AGAGAAAAACTCCTTGGTGCGCTTTGATGCGTGGATGCTTGCATTGTCTTGCTGGAAGATAAAGTCGATACCGTAGTTTAGATGAGCAAGGGGAGGAGAT
ACTCGGAGACAGTGAACACGTAGTCATCCGAGTTCTGCCTCCCCGTAAGAATCACTAGAGGCGCCTTACCACGCGAGCTGAAGCCAGCCCAAACCATGAC
AGATCCGCCACCAGCCTGGCGCCTCTTGGTCTGGCGGGGTGGCTTGCGCAGGTCTCGCCAGTAGTGCTGGAAGCCATCGGGTCCATCCAGGTTCCACTTC
TTCTCATCAGAGAAGATAATGGAGTCCCAGATGACCCTAGTGTCCTTGCACAGCAGCATGGCGCTGGCCCACGCTTTGCGTTTCAGCATGTCCTCGGGCT
TGAGGGGAGCGTGTTCACCATCTTGGTGTACACCAACCAGCCACCCTTGCTAGGGTGCGCTGGATGGTGCGCACTGAAACGGTGAGCTGGAGCTCCGTCT
TGAGCTGGGCAGCCGACAACATGCTCTTGGCAGCAGCGCGGATGAGACGGCGGGTCTCGCGGTCAGAGAATGCCGGGGCAGGCCCAGGTCGCTTGGCTTC
TTGGTGTGGCGGTGTAGGCGTCGTGACGCGTCTGATGGTGTGTGTGCATCGCCCTGTGCTCTTCGCAACAGTACGGGTGCTCAGCCCAGCTTCTCGTAGC
CCTTGGATCCTGCCCTTTTCGCGCTCGGTCACCCGAGGCTTCTTCTTGCTTGCCTTCTTCATCTTTGGAAAATGATCCGCTCCACTGCACCCAGAGTAGC
GATCTCGCAGCGCCAGTCGCTCAAAATGCCAGTTGCACGCCACTCATTTCCCAAAATTACCGTCATTATTTTATACTTGATTTTTGTACGCTTCGAGTGG
GTGATCTAATGTGTCGCTATGCTTAAATGGAATTTTGTATTGGAGGTCCCCCGCACGCTGCGAAATTGCAATCGTTAGCACAAACCACGTTGGTCTATTG
GTGACAGAAGCAGCATATCTAAACAGCAATAGCTAACTCGTAATATTGACAGAGCTGTGCCCTCAAACGAGGGTGGGTGATTTATCTTGTCGCGGAGTGT
A