Description :
From Genome Similarity Track
Location :
Scaffold_234:25594- 31375
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_234-fgenesh-gene-0.7Fumarylacetoacetate hydrolase
Pytul_var.sporangiiferummaker-pug3_contig_234-snap-gene-0.32Vacuolar protein 8

Sequence
5781 bases(100 bases per row)
GGAAGCGCCAGCACCAGGCGCAATCGCTGGGTACGAGACGCTCACACTACTAGGCAGCGGCCAGTACGGTGATGTGTACCTCGTGAAGCGCAAGCGCGAT
GGACAGCAGTTTGCGGCAAAGCTCTCGAACCAGGCAGGAGCCAACCGCATCCACTTCCAGCAAGCTAAACAAGAGGCCGAGCTGCTCAGCCAGATGCAAC
ACCCTAACATCACACAGTGTGTTGAAGTGGTGGAAAATGGGGCCAAGTTGGCGATCATCATGGAGTATGCGAGTGGAGGCGATCTGGGTTCGTATTTGAT
AACTCACCAAGAGAGGTAGAGTGACATACATACTTTGCAGCTAACCATGAATGATGCAACATTGACTGATGATTGAGCTAAATTCATAGGCACGAAGTCC
TAAGTGAGGTGGAGATCATGCGAATCTTCATCCAGATCAGTTTGGCGCTATGCTATCTGCATGAGCATCGAATCCTACACAGGTATGTTTTTGCAAAATT
GGTTCAAATTTCTCAATGCGCTGACAATGTTGGATATACTCTCGAGTGCAGAGATTTGAAGCCAAAGGTAATGTGGAGTTCTCAATCCCTGCTCTACGCG
CGCATATTCCTGCGTTCTCACTTTTCAAAACGCAATAGAATATACTATTAGACGCGAACGGAATTGTGAAAGTGAGTGACTTTGGCGTATCGCGGAGATT
GCAGGACTCGCTCGATGCTGCACACACTGTCATCGGGACCCCATTTTACATGTTCGTTCTCCAGTTGAGCCATGTGACCGAGCTGCTGCCGCTCCCCTCA
TAATGCGATTTGTATCTACCTTCTTCCTCCTAGGTCACCAGAGCTAATGGAGGACCAACCGTACCATTCCAAGAGCGACGTATGGAGCCTGGGATGCGTG
CTGTACGAACTCGCCACTTTCTCCCCGCCATTCAACGGGAAAGCGATTGGTGCTGTCGTGTATCAGATCCTGAACGCGGAGCCCGCTGCGCTGCCCTCTC
GATTTTCTCAGCCATTTCACGATTTGGTAAAGAAATTGCTTGCAAAAGATCCAAAGGTGTGTATAATTCATTAGATGTCGCGGTCGACCAGTTACTAAAT
GCTGAATGCTGTCATTCTCAAAACGACCAGGAACGGCCAGATATGAAGCAAATCCTTCGAAGTGACATCGTACAGAATCACATGTTCCATCTGATGAGCG
CGACCACATTTCAGCAATCGAGATACTTGCAGCAAAGCGCTCTACGGATCGCGATGGATGATTGCCATGGCAATCCGATTAAGGAGTGCTACAAGGCAAT
GGTAATGGCATTTGCTGCCCCTACCCATGCTCCTCATGAATACCAAACCCAGCACAACCAGGCCCAGCAACAGCAGCAGCAGTACCCAGCCTACATTCCA
CCGAAATCAGTCCAAATTCAAGGCGATGCTGCTACAGCACGGCAAATTTTCTTCGAGAACCAGGTTGAAACGCAGCTCATGAAAAAATACCACTACACGA
AAGCTGAATTTGTTACGATGATCAATCCTCTCTCCATGCAGGCAGCCGCGCGAAAGAACAAAGAGCGAGTCGACAGCGAGAAATCGGCACCGGCAGCGTT
CATGGAGCCCCCTGGTGCTCCAACAGACCTCCACTGCATTCGCCAACCTCAACCGCCGGTTCTCAGCGTCCAGCAGCAACGAAACGATAGCGCCCATCAA
CTTGCTCTCGAGCAAGCGCGTCAATACTTTCTCGAAAATGCTCGCGCTGCCAAAGCCAACAAGCAGCGCGCACTGGAAGACATGAAGGGATCTTCCAGCG
ATGCACACGCATTAGATGGCGAGAGATCAGCACGCGTAATGCCTCCCCCAGTACCTCCCGCGGCCGCGCTTCACATCCGCAAGGAGCAACGCAACAGCGC
GTATGTTTGTCTGTCACCAAACCCATGCAATTCATAATGATGTGGGCTTTACGATCCTTAACCTGGGCTGATGTGGGTGAAACTCTTGTAGATCGAGCTT
TGAGGAGATGCTGGAAGTCGAGCGTCGACGCGTGCGTTTGGAGACCAAAGCGCTGCATGAGCGCATGCGAGGCCTACAGCTCAACGGCGCATGCAGCACT
CCATCACTCGTGGAAAACGCCGAGCCGTAGCGAGGTGCAACATACACAGTGTAGCCATATTGACCCACAAGAGTAGTGTAGCCATGCCGCCAATAGTGAC
ATGGTACTTAAAAATTGTGACCTTAATCAATTCATAATAGTGACATGCACAAATAGTGACCTTCAAATCCCTCTTTGCATGATGAGTGTGCCATTCTACA
ACGATCACGAAGATGAGCGCCACCGCCAAGAAGTTCCTGAGCCTCGGGTGCGTCTGTGTGTCCTATGCGCACTGTAAGATGCATACATGCATGTATGTGT
GCATCTCTCTCTGTGTCCCATGCCCTCATACAGTGTGCGTGCTTCGTGGTAAAAAAAACAGCAAGAAGATTGTTGCGATCGGCAAGAACTATGAAGCGCA
CGCGCGCGAAATGGGCGCCACGCACGCGCCAAAGGACCCCGTGATCTTCCTCAAGCCCACCACCAGGTACGCAATATTGCGCACTGCTTTGGTACATATT
TATTCTCTTCTCTCTGTTCTATTTTATGTCTCCCCTGTATTGACGACGGTTGTGCATCTTCATTTGAACAGCTACGTGGCCGAGGGCAGCAGCGTGTTGC
TTCCGCCAGGGATCGGTGACGTCCACCACGAAGTCGAACTCGGCGTACGTTTGAAGCAGCGGCTTTGTATCGTCATCATGCGGTTTGTCCCAATGTGGTG
ATTTTGATTGCGTGGACTATACGTTTAGGTCGTGATCGGCAAGGGCGGACGCGACATCGCGGAGCAGGAAAGCATGAGCCACGTCGCCGGATACGTACGT
CAAGGCACCTTGCATACATTTATTTTAACAATAGTATGGGATCTAATGCACATCGCTTAATTGTATGCGTTCGACTATGCACTGCAGGTCTTGGCGATTG
ACATGACGGCGCGCCACCTGCAGGACAAGGCCAAGNNNNNNNNNNNNNAGGCGGGACTCCCATGGACGCAGGCCAAGGGGTTCGATACGTTCACACCTGT
GAGCGAGTTTATCCCGAAGGAAGCCGTGCCAGACCCGCACAACCTCGACTTGTGGCTCAAGGTCAGTGTGAATGAAGCTCACACGTGCCATTATCTCAGG
CCTTGATCTCTAAGCCATGTATCTACAAAAAAATAGGTCGATGACGAGCTCCGTCAAGACGGCAACACGTCCGACATGGTACACAAGATCCCGTTCCTTA
TCGCGCACGTGAGCCGCATTATGACGCTCGAAGAAGGCGACGTGATCATCACGGGAACCCCCGAGGGTGTCGGCCCAGTCCCGCCTAACAGTGTATGCTA
CACGAGTTTCTCCTGGCAAGCAACCGAGGCTTCTTGGTTTACTTATACGCGTGCTTACTGTCTTGTGTGGGATTGTTCGTAGGTCATGACGGCTGGCATC
AAGGGACTTGTCGACGTTCGCTTTCCTGTTGAAACCCGCAAGTACAAGTTGTAGGAACAGAGGCTCCACCACATATCCACGGCACAGCACACAAAGGTTT
TTGTTTTGTTGATGTTGATGTAGACTCTGTCATTCGTTCCCTGCTCTGTGTTTCTCCAACCTACATATAAAAGCAACACTGTCTAACTGGTGACCAGACG
CTCCATGACAGTCACGAGCGAGCTATCGGCCTGCAATTTCCGCAACGAAGTCATCTTTCGCAGCCGTTTCCGACGATTGAAGATGTTGCGCGCGAATTGC
GCCCGCACTGCCCAGCCTCGGTAAATCGACTGGATTCGGAGCGCCGCGGCATCATGGCGCAGATTGCGAATCGCTGTGAGAGCATGCTCGCGGACTCGAG
TCGAAGTATTCGATGCTTTACAAAACTGAATTAGAGTGCCGAGCACACCGCACTCGACGAGTTTGTTCCGTGAAGCGTGCACCATGGACATGGCTGCGAT
GGCGCGAGTCGCCTCGTAGAGCACTTCGTTGTTGCGCGAGACCGGACACACGTACTTGACGAGGATCGCGAGCACGCCCTCGTCAACAAGCTTCAGGATA
TTCTCGGGGCGCTCAGCAAAGTTGGCGATCGTGCGTGCAATGTTGTACCGCGTTTGCACAAGCGGGTGAAACGCGAATTCCTTCAGCGCTTGTAGCAACT
GCGGCTTGCACATCGTGATCCGTGAGTTCTCGTCTTCCGTGAGCTGCGCGATCGCGCCAATTGCATCGACCTTCATGCTGAAATCGTTGCCGTGCAAAAT
CCCAAAGAGGCATTTCACGACTCCACGCGCCAGCAGCTCAATGTAATGTTTGTACTCGGCTTCTTCGGTGGTATCGCGCTCTTGTTTCTTCTCGGCCGCT
GTCTTCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTCACGGTGTCCGAGTGGATGAGCACACTGTTGGTCTGCTGCTGCTCGCG
TTGTCGATCGCGTTCGCGCTCCTTGCAGATCAGGAATGTGAGCAACGTGATCACGGACCGCCGTAAGCGTTTGTCGGGTGATGCGTACAGGTTTTTACTC
GCGATGTAGTCAACGAGTTTGGACCGGATCACGTGCTCTCGATTTGTCGGATTCTTCGCCATTTCGCAAAAGACCACGAACGCAGGCCGCAAGATCGCGC
TCATCTCACTTGGCACCGGCAAAGGGCATGAGCTATGCGGACGGGGTATGAAAGATGCCGCCATCCCAGCGATCATCCCTGCCGACGCTTGCAGTCCAGG
TCCTGACTGCGAAATTGCAGATCGTCGACTTGCCGCGGCTGAACTTGGGCGATGTTCAGGGAGGAACCCATTCGGCTTGTGCGAACCTAATCCACTCGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGGCGGAGAAGCAGAATTGCACGATCCGAGGCAACGCATTCGCAGCCACGAGCGCGACGTGGT
TCCTCTTATACAGCGCGAGTGCTTCGATGATCGAGACCACGAGCAAACATATCTGTAGGTTTGTCTTGGGCGAAGCGAGAAACAGGAGCAACGTCGACAC
CAAGTTGAGTTCGACGAATCGGCGTCCGTTTTCCTCTTCCGATACCAGCAGATGCACGAAACTCAGCAGCTCGCGTCGAAAGCGGAAATCTTTTTCCATG
TACGGATCACAGAGAATCGAGGCGAGGGTCTCGAAGTGCGTCGTCGAGTGGTAGAAGAGAAATCGATTGTCGCGACACGCAGCCAGTTGATGCAGAATCG
CGGCCGCGAGGCAGCGGATGCGTGAGTCCTTCGACGTGCACGACGTCAGCATGAACGCAAACCCTTCTCGCTTGGCGACCACCTCACGCAGCTCATCGAT
CGTGACGAGGTTCATGATGATCTCACACGCGATGCGTCGGAGCTTGAGGTCCGTGGCATGCAGCATGGAGAAAATGCAGTCCATGCCGTCTGGGGCTTGC
AGGATTTTCGTTTTCACGGACGGTAACCTTACCATCGACGCGAGTGCCTGCGCGCAATCGCGGGCGATGCTCGCGTCCAGGCGATCTTGATACGAGCTGA
GCATCGAGATGAGCGCTCCGAGTGCACCGACTTCCGACAGGATTTCCAGATTCGCAGCTACAGAGCACATGAAAGAGAGGGTTTAGCATGCTCAACTCTA
CCTTTCAGCTCAAACATATTGGAGGTACGTACTGTTTCGACTCAAGGATGCAAGTGCGGCGGCGGCGTCGCGACGCACTTC