Description :
From Genome Similarity Track
Location :
Scaffold_274:25593- 30018
Transcript NameFunction/comments
Phyke_g7607hypothetical protein PHYSODRAFT_344331

Sequence
4425 bases(100 bases per row)
ACTGGCCTTGTAGCTTCATCCCTGAGTCGTCCTTACGACTTACATATCGAAGATGAACTCGCTCACGACTGGGAAGTGGTCCGACAGGTTGTACTGTGGT
TGACCACGCCAGGACcatggcgacgacgaggtcAGAGGCTGGATCCAGCTCGTGGCTTCCTTCGGCTGACGATGTGTGCGAGAGTATAGAATGTAGTCCA
ATAGCTCCAAGCTGCCGTCGCTACTGAGACCGTCAGCAGCCAAGGCATTCACACGTGGATCGAAACTGTACTTGCGGCAGTGCTTGAACTCCGCTGCCGA
TACTGGCTTGTCCGTTGCACTCACCTCGCCAAGCTTCCGTGGACGCACCACGGACGGATCGTTCGCTTCGAAAAGAGACAGCATTTCGTCATATTCTTGA
GTTGTCTTGTTCAGCCAGTAGTTGACATTCAGGTCTCCGACAAACAATACAGTATCGTTTGTCTCATCGATGTCCATGGCACGCATAAAGTTTTTGACCA
TATCCATCTGCATTTTGCGCATGGAACGTGACAACGGGTCATCCCACGCTTGAAAGTGGGTCGAGAAAACGTGCACCAACAATCCGTCCTTCAGGATCTT
GCAGTATAGCACGCCCTTGTCTGCAAGCTTGTCTGCACCGGCGCAAGCACCTTCAAACAATTTCACTCGCACGCTTAGAATCGGGTACTTGCTAGCAAGT
AGCACCCCAccgttcagcagcttccgcatGTTCGACTTGTTCATGCGCTTGTGGCCTACAGTCggcgagaagaagaagtatCCTGCTTTCGCCATCTTGT
CCAGCAAGGTATCCCGCGCTCGATGGTCGAAGCATTCAGTCAATACCCAGATATCACAAGGTGGCAAAAGGTCACCGATAAGCCGCGCACGAGTGTTCTT
CTTAGGAGAAACACTCGTGAACGCACTCACCTTACGCGGTAGCATCCAAACGTTGTATGTGCCGACACTTAACTTGACCTGACGCCTTTCCAGATGAGCC
AATAACCGCGTGGATTCTTTGGCCATGCACTTGAGATCGCCGCCTTCACGAAGCGGTACGATCGTGGTGGGGGTCGCCTCCGTCGTCAAGTACAGGTCGC
TGTCCTTGTAGTATTCTCGTGGACGAATGCCACATGCGTGGCCGTTAAAGGAGGCTACCAGCGACAGAGGCTGTCCCCAGCGCAAATATTCGTCACTAGG
GGCTACTGGAAGACGGTGATTGCTGCCATTTAGTTGATGACGCACCGGCTCCACCGTTGCCACGTAGTACTTGCCCATTGGATTGTTAAACGACATGTTA
GGCAGGTCTTTCATGAGTTGCTTTTGTCTGCGTCGTAGTTCCTGACGGTCTCGTTGACGGTCCCgtgactgctgcagcgtatCAGTAATGTCAGAGACAA
TGTTCATGTATGATTCCGAAATGGATCGGTAGAACGGATGGGATCCAGAGAGAACAGCCGATGCCGATTGACTGGCGGCACGTCGACGACCACGACCCGA
CGATGtaggtgctgcaggtgctgcctCCGAGCTGCTCACGACAGTCGCTCCTACAGGAATATCCCCATACGATAACGCAGACGGTCTCGCCCGACGGTTG
TTATCTgtgtcagctgcagcttgaatcTCTTCGACGGTGGAGCTGGTCCCATCCAAACTGTGTCTTTGGGCACTATATTGCATCGTTTTCGAAGCCTGCT
GTTGACGTCGGGTCCGTGTGCGGTAGTTATTGGTGCCAATGAGGTTCGGCAGCTTCCTCCCTCGCGGGTTGCTGGTCGGGACCTGCGTTTGACTCTGGTC
CTGCAAGTCCACCATgacatcaccttcttcatccagaacCTCAAtctgctcctcctgctctgcTTCATCCTGTGTTTCTCTTCTCATCGGGGCCGCCACA
GTCGCTCTTAAAGCACCTATCTCTCGATTATTGTAATTGCTATTGGTACCGGCAGAGGTGAGCGCTGTTGTGAGCGATTGCGGGCGTCCCCTCTTGATGG
AATTCAACTGTACTGAGGACTCTTCCACCGCAAAAAGACTGGCTCGAACCTGACGATGGAAAGCCAGGTTAACCGGGGGTTTACTGATCGTCACAGCCCC
GCGATGGCTCAAATATCTGATAGCTCGCCCCGTTTCAGCGtgaaccaccaccaaaggAGCCCCAAACCGGACGGGGGTCCCGACACTGGAGAACACCAGC
TGTTGTTTCTTTGGGTCAAACTCAAAGAGTCTGAAGGCCACCGTGCCGTGTGCAGTCTTGGAGTGTTCCCCTGGAGTTTGAGGTTCACCAGCGACACCAC
TCGTGGTGGTAGCTTGACTCTGAGTTAAACTTTGACTCTGGGTTAAACTTTGAAGTTGGGGTTTGGAAGGATCACGACGAAATCCCCCCAGGAGTGGCAC
CTGGTCAGGGTTCGAGTCGGCCAAGTCATCTTTACTGTAGATCTCCTCGCCGAAGAGAGCAGCGTATCGTTTACGGAAGAGTCCTCTACGCCACACAAAG
AATCCTGCGACGCCCATGAGGCCGCCGGTCGCTAGTGTGGAGGCTGCCAGGAGCGCCATTTGCTGATAGGTCAGGTTAAACTTTCTGGCTAAGGTTAACA
GTTGACCTTCACACAGGAAGCATAACCGATCTCCATAACAAACGTATTCTTCCATGTCAAGTCCTGGGTTTAGACATACACACATAAAGAGTGGATGGGT
TTAGACACAGTAAACGGGTTTAAGACAAAGTCGAACGTGTCTCACCTTCGCTTTTAGAGAATGGCGGGCGTCCTCGGCGCTCGCTCTGGAGAAGCGGCAT
TTCGTCAATGTCCTCTGGACGCGGCATGGCGGCGGACTGGCGTTCTGCTGCTACGTCGCGCGACGCGCTCTACTGCTTGGCGTAAACCCCAGCGCTCGTG
TTGAGTCCGCCGGTCGTACGATAACAACGCTGAGTCTTCACGCTTGCACGTTACTTTCGAAAGTGGCAAGCCTTTCGCGAACTGTATTCACAGGGGGGGA
GGTGTAATCACCGCGGATCCTGTCTAACGgtctgtgattggctgaCATTATgatttcaaccaatcagaacGCATTGTTTGTTCAGGATTGTGCGCCCATC
TGTCGTGCCACTATTTTATGCACTCCTTAGCTGTTGTTGCCCAGGCgtatttttgctttttaAGAGATTTGTGTTTTGACCTGATCGACTGGCAGCAGAT
CCTCGGCAAAAAAGCGCTGCCAGTGACTTGCTAAAGTCCGCCGTCACGAACAGAGCCTCGTAGCAAACACGGTAGAAATGGTTTCGAACCTAATGAAGAT
GTGTCCAACGTTCCATTCTGAATCCAAGACTTCATCACCGTGGTGGTACCGTACGTGCGGCACATTCAAAACCCGTCTATCACGATATCAGGCTGAAGTT
CAGCACGACCTTACAAAAATCTAGTCAACGAGATTTGGCCAAAGTTCAATCTTAACCAGGTGGTGATAAACAAAAATCTCTTAAAGCAATTGTCAGCGTA
GTTTCGATGCGTATATTAGCTTGTTCCGCAAGGGTCTTGTGGCAAGGcaacaagcaacaagcagcaagcaacaagcaataagcaacaagcaacaagatCC
ACTTGCAAATCTGGTCTTACTGGGTTTCAAAAGACCGTACAGTACCGCGTAATCGTTCCACCGTGCATTCAAACCCTGTCAAACATGATCTTCCGGCCAT
GAACGACCGTGCAACCAAGCATGCATGATCTGCAAGGACAGAGCACGATAATGTTCATCGTGTCTTGATTCAGGCACGACCGCGAGTGCCGCCGATCTCg
catcgtcgccatcctcaaTCCAATGTTTTTGTCGCTACGTTTAGTAGCTAAAACATTTTTCCTCTTAGAACTCTCCTCTCAATCTTGCATCTTGCGGATG
TACCGCCAACTGCTCTGCGATGCAAACAGGGACAGGCAAGGATCCCTTAACGTGGCAGAGATGGCCAGAGGGATCCATCAGAGAAGCTCAGATACTTCCT
GAAGGAGGGATTACTGTCCCAACTTGCTCCGTTCGAGAAGCTCACGGTTTGTTGGGCTTTCTCCTGAGGATCAGTTTGTTCGGGGCAGTCCGTTGTGACT
TACGCTTTCACCATAGGCTTTCAGGCGATGCAGAGTTTCGAGCAATGCATGAAGGTTAAATCAAGGTTGTGATGGCACACAATCAAGAAGCCCGTGCATT
TTCTACGGACGAGACATCGGCGTATCTTGCCAGCTGGTTGCCTGCCGCAAACGGACGGATACATCGTCCCCCCATCGTTATTCATCATGCATTTCATGCC
GCCGAAATACTTAGTCCATGTGACTGTTATAGCTCGACTGTCGAGCAATACGAGCGGAAGGTTGACTCAAAATGACCAAGACATGGTACTTGCAAATACA
TGTAGGACGAAAGCACTTAATATTC