Description :
From Genome Similarity Track
Location :
Scaffold_1381:2559- 4073
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1381-snap-gene-0.1GA21451

Sequence
1514 bases(100 bases per row)
AGCGCACTCGACCACGTTCGGCTCGTTCGCGCGTTCGTTCTCGTTCACGGGCTCGTCTGGTCCACCCAACGACCTGTGAAGGGCTGGTTCGGTGCCAGTG
AGCGGGTATATGGGAGGGAGTGCGTTGGACTGGACAGCAACAGGAGTGGCGTGTGCGTTTGTTTTTGGTGAACTCGGTTCAGAGTTCGGTCGTTGATTAG
TTAGCATTAGGGAGATTTTAGGTTTTTAGGCTGGAAGCTGCGAGACGAGTGCTGTATATTTACGAGAGAAGAAAGAAAGACAGGCAAGAAACATTGAGCA
ACTCGCCCGAAAGAACAACACAAACAGAAACAAAAGCAGCTTTGCAGCAAGCTCCCTTACTCTCTCTCACTCTCACAAACAAACACTGAGACCTTGTGCG
TGACGTCACCAGCGGCGTCATTATGATCTTTAAATCGGCCAGTTTCCTGATTCCCACCTAGTAGTGAGAGCTAGCTGTCGAGTTCACGAACTTGGTAGCT
ACGAGGAAACATTGTTCTTCGAAGTACAGAACTACCTACCCTCCAACCGATTGTCCCGACTTTGTGATCACAATTTCTTCATTCATATTCACTCTTTCTC
CACTTGTGCTGTCTCTTCCTTCTTCTTCCTCTCTCATTTAAATTACTAACTATCCCCATTTGCAACACGCTCTCCTACTCATACACTATCTTCACTCCCC
CTTGGCTCTCTCCTGTTCTCGCGCTCGCATTGCGTGCTTCCTCCTCGTTTTCACAACAACAACAAAATCGTCACCACCACCACCGACCGTTTTCCTCCTT
CATCTTGATCGAATCGGATCGAATTGGTCACCCATCGTCAGCCACCAACCACTTGACACCAAATACAAAATCGCCAATTTCTCAAATCAGCTGCAGGCAC
CCTGGGGAGTCGGGATTGTCAGCGCTGCGAGGCATCCGAGGTCGAGGCGCAGGCTCTGCGACGGGGCGACATCGGCGCCATCGAGAGCGCCAAGAGCTCC
GCTGCTGCTTTGGCTCTGACTGCTCTGACTGGAGCTGTCGATCGCCATGCCCCACGAGGTCGCTGCTGCTGCCACGGGGGACGCAGGCGGACTCACGTGC
GGGATCTCGATCGGCGGCTGGGTCGTGAAGTGCACTTTCTTGAGCACACCTTGCGCCTCTCCGTCCGCGTCGTCGAGAAGACTGTCGAGCACCATCATGT
GGCTCGACGCGTCGCCCATCGAGTTGTCGGACGAGCCCTGTGAGTTGCCCGACTGGCCACGCGAGCGCTTCCGCGCCGGCTCGTCGTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTGAGGTCTTCCGTGCTGCTCCGTCGCTGGTGGCCCGGGTTTTGCATCTGCTGCTGGTCCTCGTCGTGTGG
GTTGTTGNNNNNNNNNNCCACTCGACGGGTACGCCATCGGGTCGTCGTTCTGCATGTTGGGCGAGAGCTCGATGCGATACGAGATCGCGCGGTTCAGCAG
CNNNNNNNNNNNNN