Description :
From Genome Similarity Track
Location :
contig_57:255825- 257343
Transcript NameFunction/comments
g10991.t1POM68382.1 Amino Acid/Auxin Permease (AAAP) Family [Phytophthora palmivora var. palmivora

Sequence
1518 bases(100 bases per row)
CTTCATCACTTCCAATTTGGCTGCCTCCAGCTCAAGCCTCTGATCAACAGCGCGCTCCAATCCTTTGCCGTCCCTGACAACCATGGCTAAGGGCCCTTTC
TTCACCGCGGAGGACGCCAAGTCGGCCTTCAACCTCTTCTGCTGTATCTACGGCGTTGGTACTCTTGGTATGCCCGGCAACTTCTCGCGCGCCGGCCCTT
TCCTCGCTGTTGTCGCCATGGCCTTCATGGCCTTCGCCAACATCTACGCGTCCATGACCATGTCCAAGGTCATGCTGCTCGCGCCCAAGTCCGTCAAGAC
GTTTGGAGACCTCGGTCAGTGGTGCATGGGGCCGATTGGTCGCTGGCTGTGTATCGTCTCGCAAATGGGCTCGTGCCTTCTCCTCCCGTGCGTCTTCCTG
GTCCTCGGCGGTTCGCTGCTGGACGGCCTCTTCCCGGGAGCCTTCAGCCAGACGACGTGGATCATCCTCATGGCGCTCACGGTGCTGCCTGTTTGCTTGG
TGCCCACCCTCAAGGAAGGAGCTGGCGCCGCCTTCGCCGGATGCCTGGGAACGATCATTGCCGACATCATCGGCGTGGCTGTAGTCATACACGGACTCAG
TGGCCACCCGAGCGTGCCGACACCTGACCTTTCGTTCGAGCAGGTCGCTGGCTGCTTCGGCAACCTGTCGCTCGCCTACGGGGCTGGTATCGTGATCCCG
GACATCCAGCGCCAGCACAGCGACCCCAAGCGCATGCCGCGCGTCGTGGGCGTCACCGTCGGCATCATCTCGATCCTGTTCCTGGTGCTAGCCAGCACCG
CGTACTCGGCCGTGGGATGCCAGATTTCGGGCAACCTGCTCTTCACTATCTACCCGGACGCGGACACCGGCCTCACCAACCTGGGCTTTGCGCCCAACTG
GGGAACCATCGTGCTAGCCTACCTCTTCATGCAGCTGCACATCACGATCGCCTTCGCGGTGATCATCAACCCGGCGTTCTACATCGCGGAGCGTCTGTTC
CTGGGCATGCACAAGGCGGAGCAGGGGACCTGGAGAACGCCACCAGCTACCTGCAAACAACTACTCCGGCTGACCCAGCCGTGGTCCGTAACTCCAAGAT
GTCGTACGTGTCGGTGGCCGACGCTGAGAACGTGCACAAGGACGATTCCGAGAAAGAAGCGATGGAGTACCGCGGTGCGAACGCCATCAAGTACGTCGTG
CTGCGGTTCATCCTCGTGGTGCTGCTTGTCATCATTTCGATTGTGCTGAAGGACGACTTCACGTCCCTGGCAGACTTCGTCGGCGCCTCGTGCATCACGG
TGAACTGCATTTTGCTGCCTATCGTCTTCTACCTCAAGATGTCGTGGGAGAAGGCTGCGATGTGGGAGAAGGTCTCGGGGAGCATCGTGGTGGTGATCTG
CTTTGTGTTGGGCTGCTACGTGACTTACACGACGGGTAAGGAGCTATTTGCTCCGTCAGACGACGAGGCGGAGTTCCCGTACTGCACACCGGAGTTCGAG
AACACGGTGTACTACAAC