Description :
From Genome Similarity Track
Location :
contig_28:25581- 27955
Transcript NameFunction/comments
g6873.t1hypothetical protein

Sequence
2374 bases(100 bases per row)
CAATGTCAGACTTCACGGGTCCGGAATCAACTAATTTTCTCAACTCATAAACCATCGTTGAGCTGTAATACAACATACCAGTATAAAAACAGTTAGCCTA
TTGCGCTATCGATACTGCAAGTGCATGAACGTACATTTTCTTAGGCACGTGATTGACGAACGCGTGGAAGGCTGCCTGGTTTACCTCCCCGTTCGTCGCT
GGAGCCATCAATACTTGCAGGAGGTGGATTTGCTCCGCATTTAACCGTTTTCGTCGCTGCCGCAATATATGGTTAATGGTTTCGGAATCAAGTCGACCGT
GCTTGGGCTTCAACGAGCGCCACGCAGATGCCGAATCGATATTACCGTCTTTTGCCAACTTCTTGTTCTGCTTTTCAAGAGCCCATGTTCGGAATTCCTC
TGCTGCCTCTGCGATTCGACCTGCCGATCTAGCTGATGCGTCGCATATACCAGTAATGTAGCTCAAGAAGTCCGAATAATCGACGACGCCGTCTTTGTTG
ACATCAAAACGCTGGATAACTTTGCCGAGTTCACCGTTCGTGAAGCTCAGCTGGTTAGTCGCAAAAATGCGTTGAAAATCGGACCGGCTGAGCTTCCCGT
CTCCGAGTGTGTTGTACGACTGAAAAATCAATCTGTAGTTTGGAACATGATAGCCAAAGCGCGTGGTCATCGTACGCTGCAACGAGTTCACCACCTCATC
ACTTCAAAGGCACATAACAGTGAACATTAGTATTCAGTCTACGTTCGGTTCATGAAAACGCATGTTCTTACATTTCGAAGTCCGTGAGTTCCAGAAACTG
TCCAAACGTGCCAACGTGAACGACTTTAGCTTCAAAAGGGTTGATCCGCTCCCAAACAAGGCGGAAATCCTACAAGCAGAATCACACAGTTACTTTTGAG
CCATAATACACGTCATGCAACCAGTCTCACCTTTTTGTCCATTTTGATCCCAAACGTCTCAATCCCACTCAATACAGCTTGCTTGGTAATGGCTCGAACC
TTCTTCGGATCAAACTCCTCAAACAGGCGATTGAAGTTTAACGAGCAGTCTTGATCAATTGGGCAGTTCCGCCGCAGTGTTTTCCGTACTTGGGCCTCTA
AGTCGTCAATGTGACGATGCAGATTCGCCCTAGTGCGCGGTGATGCAATAGCAAGGTCGATTTGAGGAGGTTCAACCAGATCCTGGCTCGATAATGTGCG
CCGGCGCCGCAACCACAAGAAGACGCCATGCTTAGGGTTTTTCTCGTTCAAGTTCCCTGGAACCAATTTAAATCCGCGATGACGTGGAAGCCACAGTCTT
GCAGTGTTCTTGTCACTCAAATCTCCGCTCGTGAGCGACAGCCCAATCAATTCGTTAGTCATTTGCGTACTTGATGGTACCAAGCTTGTCCAAATGTACT
TGTGCTTCCCGAAGGCACCGTTCCGATTTATATCTTGCTGCAAACACGTGTATCCTTTTGACACCAGGTCCGTGTCGCGAGAACTTGCAGCGTACTTAAT
ATTGGAGATAGCAGACTTCCCATCCTCCTTCGCCGCTGTCCGAAACCAGAGGTGCATAGGACTGGTGTTGCTCTCATCCTGCAGTTTTGGGAACAGTTGG
GCATAGTTATCCCTTCGTAGGGTAACTTCCTCAACGCTGTTTGTTGATATCTTAATATCGACGACGCCGTTCTCTCGACAAGGGTGCACAAGCTCTTCGG
CCGCCCTTTCATCCTTGAGGAGCAGCTCGAGGTCGTGCACTTTCACCATACCATCTTTATCCGAGTCCATAAGATCCATCACAAACGCGAGTTCCTTTGT
ACACAAGAATTAGTTCAATAACGATAGAAGTCCACTACATCCCAGTCAAATTGCAACGTACTCCAGTTGTGAGTGCAACGTCTAAATCTCGCATGATAGC
CGCATGAAACAGCTCGGGGGCCATCGCCGAACCATCAGGAGGTGTCAGTCGCTTGAACGTGTCTGCGATCTCATTATCCGTCAAGTCCAAGCTCCTCAGA
TGCTTCCGATACTTGAAAAGCAGCAGTCGGCTGTCAATCAAACAGCAAAACAATACGTACCCAGACAAGATCAGCAACTACATCATAGCCACAGCGGCAA
CAACACTAGCCTACGTACAGTTGGTCCTGGTCCAGCAGACAGAACTCTACGAAGTCTCTGTGCAGCAGTAGCTTCTGGCAGTCGCATTCGATGCGGTGAA
AGAGCGCGTCCACCTGGTCGCTGGGGATGGCGCTCTCGAAGGCCGGGTCGCTCGCCACGAGCTTGCGGAACTCATGCGCCTCCAGCACGAGCTGCGGCGG
CTCCCCATGCGCCGTCTTCTTGATCTTGGGCGCGTGCTGCTGCGACCCGAACTTCTTCATGAGGTCCTTGAGGT