Description :
From Genome Similarity Track
Location :
Scaffold_8:255807- 258756
Transcript NameFunction/comments
Physo_305981Hypothetical protein
Physo_550028inorganic phosphate transporter, putative

Sequence
2949 bases(100 bases per row)
GAGAAGTCCCAGCAAAAGAACGAGCTGGAGCTGCTCGAGTCCGAGGATGCGTTGCTCATCAGGCGCGTCCGCCAGTATCGACTGAAGCCGACGCCCAATG
GACGCGTGCCGGTACACGCACAACAAGTGCGTCGAGTACCGGCGCAAGGGTGGTGATGGAGGCAAGGACAAGCTCCAGAAGCTCTTCGTAGCGCGGCCCA
GGCTGCGCCAAGTCCCGCTGGAGTACCCGGAAGACATGGGGCCGGCCCCCGAGTGGGTGCTGGAGACACCCTCCTCCGTGAGAAAGCACGCTGTCCGTAA
CTTCGTGTCCGCCACCAGCGCGGCCTTCAGGAACCTGGCGCGCGGCCACATCACCCACTTCAGCATGCACTTCAAGTCCAGACGGGAGAGCAACTACTTC
ACAATATACGCAGACGCGGAGAAGACTCACCTCAACTCAGCACGACACCACAGGAGCACGCGGCACTTTGGTCCAGCGCCACTTCCCCGGGACCGCAAGC
CTAAGAAGGTGGATCAGTACCTAACGATCCCCTCCGTACCCAACATCCTCATCAGAGCGGACGAGGGCACGGAGATCGAGGGCGAGGTGCGCATCGTGTA
CGCGCACGGATACTGGTACGCCCAAATGGCGTACGTGGTCGCTCCTCTGCCCGTGGAGGACAAAGGGCGCTGCACAGCGGGGGACCCGGGTCTCAAGGGG
TTCCTGACCACGATGGACCTGCAGGGCAACATCGCCCACCTTGGCCGCGCCAACTGGGGTCGACTGTTGAAGCTGAAGACCCGCCAGCGAGCGGCCCAAC
GCCGAATGAGCAGGTTCGTGGCGAACAAGAAGTACCGCAAGCGCCACCACCTCGGCCGCCACACAGGCCGAGAGTGGAAGCAGTTCGTGGCAGCTCGCCG
CGAGTTCTACACCGTGACGCCCAAGCTGGACAACTACGTGAAGGACCTCCACTACAAGGCAGCTTCACACCTGTGCCACAACACGGACGTGATACTGCTG
CCCAAATTCTCGACTTCGTCCATGTTGCGCTCAAGTGCCCCGTGGACGCACGCGTTCAACGACCAGATGAACACGCTGGCCCACTACCAGTTCCGGCGGA
GACTGCTGGCGAAGTGCGAGGTGGCGGGCGAGGCCATGGTGCTGTGCTCTGAGATGTACTCGAGCCGCACCTGTGGCCGCTGCTGCCGCCTCCACCTCAC
ACTGCGCAACGAAGATGTATTCCGGTGCCCCCATTGCGGCTTCCTGGCTGGACGAGACGAGAACGCGGCCTATAACATTCTGCGGTTCGTGTGCGCGGGC
TCTCTCTCGGTTTACGCAGTGAATGGTGTCAGTGCAGTTGTAGTTGGTAGTGTAGTTCTCGGGTTGCAGCGAGCATGGCCCCGCCGATGAGAAGCGCTAG
GCTTGACGGGGTGAGTCACCCCCGGGTGGCGTACTGTAACACGAAGTTTCATGCGGATTGTGCCGTCTCGTAGACCTGAAAAAGTTGTTGAACTCCTCTG
CACGCGACACGATGCGTATCCCAGTGACTTCAGGTGTTCGCAGCTTCATCTTAGCTGATCGCGGGCGGTGGCTGAAGCAACTCAAGCGCAAGTTCTCCTT
GCAATGGAGAAAAACGAGGTTGTGATTACGTGTCCTCGCCGAATCTACGGGCGCGTCGAGCTCCACGTGAAGAAGCTGCTGCGCAACATTGAGCCGGAAT
CCGTCACGCTGCAGCTACCGGAGCACGTCAATATGGGCAAAATCATCGGAAAAGGAGGTCGAATGGCGAAGCAACTCGAAGCCAACGTGCAGGAGCTGCT
CTCCAGTGAGCGCTGTGGTGCCGGCCACTTGCACGTCGGCAGGGGCCAGGTCATCAAGATCAACAGCCAGTCGCGCGAGATCGTTGTGACGCTGGAAGGA
GCGTCTAGGGCCTTGATGTCGGTCATTGTCGGGCGGTTCAGTCTCTGATTGTGGAGACGCATGGACACAATACGCTGCCTCTAGTCACGCCCGGGCAGCA
GTTGCAGCAGTGCCCTCGACTCGCGCAGCTGATGAATAAGGTGCCGCCGACAAGCTGGGCGACTCGAGATGATGTCGTGCTTCAACTTGCTCACGCGCTA
GTGTGGCGCTGCAACGCCAGCATCTGCGGCGGGTTCCTTCGGGACTGGGTTGTTCGTGGTGAGAGCGCCAACGATATCGACGTACGTCTGTCGCCGCCTC
AAGTTACAGCCTCCTCTGTCGAGAGAGCACTCCGACAGTTCATCTGGGGGTCGATTGGCGCTGCTCAGTGCCAGGTTACAATCATCAGTCGGGCGCAAAA
AGGATCGGCGTTCGCGCTGACGTTCCGCGCTGCCAACATAGAGGCTTTCGATGTCGACCTCGTTGATCCGTCTGCAATCTTGAAGAAGATGCACCCTGGC
GTCGACTGCGACGCCGGGAATCTGCTGCTGAACCGGAAGCAAGCCTTGTGCAAGAAGGTCGAGGGGGCTGGGGACTCGTGGTGCGCTGCGCTGGAGAACG
TCCTCAAGAAGCAGTTTGTCTTCTACTACGCGTTGGATACACGTGATGCAGACCACAACACTGAAGCCCTCCGGCGACTTCGGACGTGTCTGTCTGCTGT
GCCGACGAGCGTCATAAGCCAATTGAGTAGGAGCGAGAGAAGCTTGATCAAACCTCAACGTGCGTAGCTCCAGCGGGTCAAGGAAGGCACAGTAGCTGGT
CGTTTTGAGCACTTCAAAAAAGGTATTACATTAATGCTTAGGAGGAAAAGATCCTAATGGTATGTGCTACCGTTCGCACATTTATTGCGGGGTGTTGTTG
GCCTTGTACACACCGTCCTTCTCAATGTCGTTCTGCTTGGCAACCGAGCTGAAGGACTCGCGCGTGAAGTCGTCGGCGCCATGCAGCTTCTGGTAGAACT
CGGCGTCCATCTCGTCGAAGCCCTGCTCGTTGTCGAACATGCAGAACCA