Description :
From Genome Similarity Track
Location :
Scaffold_376:25574- 27771
Sequence
2197 bases(100 bases per row)
gagcttgaccgtagaacactcgtagccactccgcttgaccttgcgcacgccgccgggggcagggacttggtccctgtgaagcaacacgcccgtcggtgca
agactaactctgcagcttgcggtcttcggggcaaaacaaactctgattattatcatacacatgcacatacaaagggcctatcgagtaagagtgcaaacat
ctcctgggtacaccttgaacaagggtgagacacccactaagctactggcgtggcggtgcccgtgaatgcgcgtcgctgccttggcgtccttccattggcc
tgtctgggtcagtcatcacttgattacacggattacacctgggtgcaaatcagtgatatcctgattacgccaggatcttgtggccgggattgggcggact
tggtctgtcatcacctgattacactgattactctgggtacatatcaggtgtaatccagatgacgccaagattctgtggctcccgttggcccaaatccata
ggcgactggtcaggccgaatcttgtgtgcccgacaccaggggccgaaaagccacaacggggcgacccttcagagcgaccttccaagcggcaaccgccaac
tccaaagagcaactaccgcagctcccagaccggcaatgtagccatcgcttgtgtacccacttcatatgcgagaccacgaagtcgcacttcgggccctgca
ggcaggccgtaggctttaagttacgtcctaggctcggagcgtcatctgtctttcaccagtttccacttaacatcacgaacatcgtgcatccagacaccaa
cttgcgcccacaaccaccgtgtctcagttttggcacaagttgaaggactgccgggctgaaaacctgagctgggagcaaaattatgatgcccactccatat
cctagctgtgcaaccaacttgacatgccgaattctgggactctgaggctgggaatctgagctgggggcaaaattacgatgttgattccatatcccggctg
tccaaccaatttgacaagcctcagttttggttcaacttctgggactctgagtctgggaatctgagctggggcaaaattacgatgttgactccatatcgca
gctgtggcaccccagagccgagatgaaattggacgccgcacgccacgcccttttcccagaccccagactgcacatctcagggtctggtgcaccggcaaac
cccagaccgaattccaaatcacaaagtctcagacttttgctatcactctcaggtctcagaaccccgggcactccaaactgtgaggtcgccaatctgagac
ctggggtctgaaacttaagcaaccatggacttcaattcacagatccagaaggccagggctcagctctccgcccagagtccgactcaaggcctggaacctc
agatctgcggtctctagagcgaatctcagacctcagaccccagaccgaattcaaagctcagagctggggtctggtgtcgctgcaactcggcgttcgcaga
gctcagttttccgatgtagccagcacaacttgaagtatgtacaaaacccagacttgggtcaagaaatatccacgtttcaagtgacatgtggccggtatgt
ggtagggtttgggcttctgactgatgggtcctggcctagaattggctcggacctcgtcacacaacggtggcgagtacaagtcgcgccaaatggccaaatt
ctgcagtgaccgaggcatcgtacagatattcacgcctccgtacacgcctcaattcaacggagtggctaagcggatgaaccggactttggtggaatgtgcg
cgctgcatgttGGAACATGCCtgtaatgggccctccattttcataagtagctagacatctttccgatattgcataagtaggcatggtcagcacatgactg
gcgtgtgctgactcgtcattctctgattggctgaaaggtggggaagccagtccccatcttcagccaatcagctgtcgacctttgtttgagtggttcacat
tagtcctaagggctcgcgccccggtctaataataaatcagagataatttacatcggacttaatacttagctctcagccttactgcgaacaagacaaccta
ggtgtaagccagtgacgggcatacaccaggcccgttacacctggtagcactttgtagtccttcccatgaccaagttcgagatgagtgagaaccagcc