Description :
From Genome Similarity Track
Location :
Scaffold_3:2557357- 2577716
Transcript NameFunction/comments
Phyin_T30-4PITG_02545Pectinesterase
Phyin_T30-4PITG_02546Ubiquitin carboxyl-terminal hydrolase
Phyin_T30-4PITG_02547Transcription initiation factor TFIID subunit 1%2C putative
Phyin_T30-4PITG_02548Putative uncharacterized protein
Phyin_T30-4PITG_02549Putative uncharacterized protein

Sequence
20359 bases(100 bases per row)
GAGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAGGGTGCCATTGTTG
AGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGTTGGCGGCACCCGTCAGCCAGGG
AGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGC
CACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACACC
GCATTCCCCTTAAGGACTTCACGACTTGTCTTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATACCCCTGGGTTATGCCCGAGAACTG
TCCCACATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGGAACTCCATGAAGATCAGCAGCTG
TCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCG
CTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCAG
ATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCT
TCCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGT
ACTCGGCGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGCCTCCGTCAACGTCTCCTCGTGCT
TGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCGGGGCGAGCTCGCTCGTCTTGCGGGTCGCCTGGACCTGGTGGAG
CGAGAGGTCGCGAGCCTGCACCTGCGGGTGGACCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGC
CACGTCCGGATCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTA
TGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCCCT
CGCTTCGAGGAGCTGGGTCAAGGGGGGTCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGT
CATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAG
CTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGTAACACTAAGTCACCAATCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCCGAGTACTCCT
CTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGG
CCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGG
TGGCGGAAGCCGTTCAAGTAAAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTAC
GTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTG
CAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGG
AACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCA
AAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGG
AGCCGAAGAGTGCCCTGCGGGTTTAACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACCCACTTATACATGTGGGTCCACCAGAAGGACTGA
GAGACCGACAGAAAGGTCCTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTA
CGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCA
GTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCCATGCGTATCCGAACATATAGATCCGTT
GTCACCCGCGTGATGTGGTCCAACTCATAGTCAGGACGCCGAGAGAGGGTGTCCGCAAGCACGTTGGGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGT
ATTCCGCGAAGAAGGACAGCCAACTCGCCATCCTAAGGGAGATGCGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACGAAGGG
AGTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGC
TGCATGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGGCGTAATCAGAGGCATCGCAGACGACGCTAA
ACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTTCCAGCGCCAGTC
GACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAACCCAACCACTTTCGAAGA
TCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTGA
TCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCAT
GGCCGTCTTGCCTCCCTCGACACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGA
TTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCACTCT
CTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGCTGTTCAACAACACATCCTTTCGTGGGATCGG
TGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTACGAACGCAGAAAGTCGGCGTCGAGTGC
GGGGATTTCGACTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGA
CACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGCTGGGTCGGTGGGTGTTTATTCACCACGTCCGCATACTC
CGTCACCAAAGGATACACCGGATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGTCC
AAGACAGAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTTATGAGTACCATCTCAGCGATCTCTCCAGCCTTGAGGTTGGCCAGGAAAGACTCAG
CCGTCATTTCCTCGAGGTTCAGTATCTCTGCAACCTCTGGCAACTGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCCGTCTCGCTATCGAAGAT
GTGATAGCACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGGATCCGACTTG
AGGCGGCGGCGGCGTCTTTGCCGACGGCTTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACAACATCCGAGGCACTCGTGGCCT
CGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGA
AGCGTGTTCAACGCCTCCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACTCACACAGGAAGCGTATCCGACGTCTTTCTCTTCAGTT
ATGGTCTGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCG
CCTGTGGACCTAAGTTACCCACTTGGCCGGCGCCTCTTCTGGGCGCGGCCACCATCAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCA
TCTGCCGGATGCTTTGGTACCCTGGCAGCCCTCGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGG
CGGCTGGCACCGATTGCCTTGCCTCGCCAGTCGATCCAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAA
CAGTGAACTGTTCGAGGCTGTCAAAGTCTTCAAACTTGACAGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGA
CACCGTCCCGTTGCCCTTGCTTTCTCGCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAATTCTTCGACGCCCCAGAG
TCAATCAAGATTCTAAAGGGGTGATCGTACCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTAT
CAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTC
CCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGT
GGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGA
CAAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGCC
TGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGACCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACG
CCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGCTCGCGTCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGG
GAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTCGCTTCCCGAGTGTACACCCATCTCTTAGCACGACCG
CTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAGAAGTGAAGGTTCT
CGCCTTCCTTCCCTTCCTACGGCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGGTTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATG
CGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGCCTCCATCCCGAAG
ATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGTTCAGGTAGTCTAC
CCGCGATGGCGTGGATTGACTACAAGTGCTACCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTC
AGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTT
TGAGGTTAATACAAACTATCAGTTACCTATAGAAATGCAATGTCATTTAACCAATGGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGA
GTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTACATTCAAAGCGGAGTCCTTG
CCCTCGAACACACCAATGGCGCAAATGTGGTGCACCTGCTTGCCGCACACAGTGCAGGGGTCTGTCTTGAGTTCGTCACCTTCTTGGCATCCATTCACAG
CGCACCCCATCGTTCGCGTGTACACTGAGAGTCTTTTACAGCCAGTTGTGTGCGGATTGCAAAATGAAACCTGTGGCTGGGAGGCCTTTCAAAATAGTAG
TAGTGAAACTACTATTGTGGTTAGAGAACGGCGGTAATACTACTATGAATATAGATACTCTGTACCTGGGTATGAGTATGAGAGATACCAAAAATTAAAT
GATATGAGTAGTACCACAGAGTACTATTTCACCGAATACTATTAATCCCTTGCTGGCAAAATGCTCAGGCCACGAATAATACCCTCTGAGGTTAGCAACA
ATCGTCTGGCCTTCAAATCATTCCGTATTACTAAAAAATTGTAAACATGACTTGATTTGAGTACTGACCAATATTTGTCCTGTATTAATCAGGATAAGAT
TATGGCTATCCTGTAGAATACAGGACGCGGGGCTAAAGGGGTTAATCAATGCCAATACTTGAAATTCATGTTTACCGAATTACTGGTCTACATGAACGAC
TTGTCCACCCACCAAGCGGACCCATAACCCTCCCCAAGGATTTCCGTGATGGCCACAGGTTTCTGGAGCGTTCCGCTGAAAGCTACACGCTTGGTGGTCG
CAGCCCCTGCTCCTCTGTTGTTGAACTCCTTGAAGTAGACGTTACCCGTGTTGTTGTCGCCGTTCCACTTTTGCCATCCTGCGGGGTCGACAACGTCACT
GAGATCACTGTTCTGGAAAACAACGCGAGCGTACGGCCGCCACGGACGACCCAGGAAAGCTTGCCCCGGTTTGGAACCGAAGACACGAGCCTTGTTGAAG
ACATACTCGGACGGGTTCGAGTTGTCGGTGCGGCCGTTGGCAGTGACGCATCCCTTGCCGATAGACTCAATGTCGCATGACTCAAACCAAGTCTTCGCGT
ACAGACCAAAAATGAAATCAACGGCACCATTAATGTATGACTTGGCGAAGAGCGCAGGTCCTTGGTTCGCGTACAAAGTGTCCTGGTAACCTGTGAGCTT
GCAAGCGTAGATTCCGTAGTTAGCACCGTCAATCTTCATTGCAATGGCCTGACCAACGTTCCCGGCCGTGTTTGCAACGTTGAGATTGTACACTTTCACG
TTGCTCGACTTAAGCAGCAGCGTGGTCGTGTAGTCATTGCGATTCTTGGTGATGCTGGCGGGGATATCGTTTTGCGCCATGGCACGGGTGATAGTGACCT
GATTCGCAGAGTACGAAGTCGTGTCACACGTGTAGCCCTGTACAATAAGCTTGCCCTTGAGCGGCGGGACCGTGACCTTCTCTTTATAAATGCCGGGCAT
CAAGAAGAGCGTGCTATCTCCCGTCGCGGTGGACAGCTTTGCTACCCCTTCCGACACCGTCTTGAAACTCCCCCTGTAGGCACCTGTGGCGTCAACGACA
ATGGCACCGGGAGGCGGAGTAGTGCGCGCGTTCGGTCCGGTGCACGCACTTTCAGCACCGGCGACGAGGTAGACAAGAGCGACGAGAGGAGCAAAAAACT
GCATTGTTCGTGGAGACTTGTGTGACCCGGATGAAAATGGAAAGTGAGTTGCCTGTCCAAGAAAATGTCTACAGGCACTAAGGATTTCTACCAGCTAGTC
CATCTTGCTGATCTGTATACGTACAAAAGTACCTTTTAATTCTGGTACTGGTAAGGATCATGTTACTTACAGGTGCAGATCGGACCCGTTTACACACTGA
GCTCCGGAGCTCGGTGTGTGGGCGATAGCTATTATAATGCTGCCATGCGTCACATGTAACAATGGAGTGCCTCCGAAAACGGGCGGGGTCCAAAAGAAAA
AATCATATGAGCCCGACAACCAAACATCATTTGTCGTTCTAGGGAGCAACTATCAAACATGTACTGTAATACTCTTTGTTTTAGTCGCTAGATTGATTGC
GTCCTGTTTCAGAATCATTGTAAACTACCTTGAACTGGTTTACGGTGTTCTGTTTCTGCAGGTGTACTTTCAAAGCACTTCAGTAATTGCTCATTTAATA
CGAGAAAATAGGAGAAACACACGCCCATCGCTGGGATAGTACACACGGGGCTGGGCGACGTGGGTGCCATAGCCGCGGCGCCAACTAAGGTGAGCGGGTG
CGAGGCGCGTAGCTGCAGCAAACCCGCGCGGAGAGCCCGCGAAGCAGGGCCGCGCGGTATTTGCGGAGGCGGGCCCAGCGCTGAGCTCACCAGCGAGCCG
AGCACTACACTTCCCAGAACATTCTATCTCCATATTGCAAGCGCAGCGAACCGCGGGGGCGCCGAAGGGGCGTCCAGTCAAGCGAAGCGCGGCTGGTCCC
TTTTCTGCTGTGACCTCAAATCGTCGATTATGTCTTATTGCGACACTCAGAAGGTCAAAACAATACAAAAGTCAAGTCAAATGATTTGCTGTGTGCTGAA
ACAGTAAATGCATGTGTTTGGCATGTTCTGTCATTTAATACTTCGTACTGTAATATAGTACGCCGTAATTTGCTCACTGCAAATGCACAGTACAATTACA
AGTATGTACTGCATTTTTATAAACATAATGAACCACTGTAATAGTTACAGTGTCGCAAATACTGTACAGCTAGCAGCAAAGCCGTGACTCCTGGAGACAG
AGTCTGTCACAGACTGGATAGGAGCGAACCGTACATCGCAGTCGCCCATCCTCTAAACAGTTTGATTACCTTGACCTAGTCACTCCAAAATATTATAATG
AGATTTAGGAGGTCCTGTTTAAGTCGATATGACTGGCTTAAACTATACAGACACTAATGGCTGGTGTACAGTTATTGGTGGCTTCCTAATACTAATAAAG
TACTCACTTCGTCTTTTGACGCCTACAAGTAACGTCTTCTTCCTCTCCCTACTCCTTCTCGACCTGTCATACGAGTTATAGCCCACGACCACCGTGGGCG
ACGTGACGGTGGAATGAGCGAAAATAGACCACAGTAACATGCTCCTGAACAGTGAAGGCTGCTTCGTCATTGTATCCTTTTTCACTAATTGTCAATCGTT
AATTCCTCAAACGCGCATGTGTTGCGGTCTGTGCTAGTCTACACATTGCAACTTTCGTCAGTTTGACATGCCTAAATCCAGACAAACCCAGAACTGAGAT
CGTAAAAAGGTCGTTGCGACGTGTTAGCGATACAGTACCACACTACTCTGCACTTTATGTCTAAGCATCTGCGCGTCGGAACAGGTACAAATATCCAGCG
CCAAGAGGAGGTTCCTCCGACACAGCCACCTTGTCATCATTAAAGATAATCCAGCGACCATCCTTCTTCATGTGACACACGTAATGTCCCGAGTTGGTGT
TCTTGCCCACGTGGCTAACAAAGCCCACAAGAGAATAGTCTCCAGTACTCTCGCTATCCAAACGCATCACAGAAGATCCCGAATCACCACTTGACACCGC
TGATTCGCTCTCACATTGAGCCACAGCACCGTCCAGATCGTCCATGTGACTGAACAGCCACTGAGCGGCGCGGTCCGGGTTGTTGTCGGTCTGCTTGAGA
GCACACTTGGCGTGCGGCTCACCGAAGCCCATCGCCATTAGATTAGACACGTGCTCCATGTTAACGGCGTCATCTTCATCCTTCACAGCGGCATCTGCCG
AGGCAGGAGGGTCGTTAAAATCCGGGTCTTCCATGTGGCTAAAGATCCACTCCATCGCAGCTTCAGCGTTGGAGTTGCCAGTGGCGATAGCAGCACGTTT
ACATCCATTCTCCGAGAACCCCATGGACACCAACTGGGCCACGAGGACTTCGTCGGCATCTACTGAAGCACTAGCACTGCTCTCAGTCGTTCCACTTGCA
GTAGACGCCTCGGGTAGTTCCTCTTCGCCGTCGACGAGACCCTTTGAGATGAACCGACTGAGAGAAAAATGTTCTGGCACCTTCACTTCAACTTCCAGCT
TCTTAGGCGTCCAGTCTTCAGCTACGTAAAAGCGTCTCATTTGCACGAGCAAGTAGCGCGGAAAGGAGCGGAAGCGAACCGTCTTCTGTGCTTGACCCTT
CTTGCCAGTAGCAGGGGACAAGAAGTCTTCAATAACTTCCGGTGCCAGCGTCTTTTCAACACACGCTTCAAACGGGACATTAGGCACGACGCGTTCTTCT
CCTTCCTTCTCACTCTTTTCTCTCTTCTCGTCTCCAAGACGCTGGCGCTTCTGTTCAAGCACCTGGTAAGCGTTCACTTGGGTGGCATTGGTTGCTGCCT
CGAGGGGAATTTGCAATTGAAGAAGCATGTCATCACGTGGCACATACTTCACCTTATTCGACGCCATGCACTGCACCCGGTCTTCCAGTTTAAACTTGAA
CAAGCTTGCAGTTGGCAGCTCCGCACTCGTCGCGCTATCTCCAGGAAGAAGCGGCCCCAAGCGACTCGCACCGACACGCTCAGCTCGAGTCATAAAATCC
AGCAAATGCTGGAGATACTCCACTGCATCTTGCTGCTGTCCCGTAGAGAAATCGGGATGGCCTTTCCCCACAAGACCACGGAACGTGATTGGTCTGAGAT
CGACATTATGGATCTCATCCTCTTCGATCTCCTTGTTGCTGTTCTTCGGCGTCACAAACTGCTTCTTGTAGCGATCCGTCAACGTCGCACACGTGAGTTT
AGCGAACTGAGCAGCGAAATCGTCCACTGGCAGCGTGTCTGCAGTCGAGAAAATCTTCTTCGACACCTTAAAATACCGCTCCTGCACCTCAGGGAGTGCC
AGAAGCAGCTGCAGCACCGAGTTCATGTAGCAGCTATTGCCCAGATTCTTGAACCCCATATATCCCGCACCTGAAACCGGTACCAGCTTCATACCAGCTT
CGGTAACTGCGTCAAACTCGTACGACAAATTCAGTCCCACTTGCAGCTCATTCATCGACTTGTCCGTCTTCTTCAAGTTGTTAACATTGATGCCAAAGTG
CTCCAAATGGTTCGGTAACAAGGAGTTCTTAACCATATCATCTTCGTCCGGTGCGTAGCTGTACACGTCTCCCCCTTCAGCTGTAATTGTGCCCAATTTC
ACGGATAATGGGTAAATTCCTCCAGTCTCACTGAAATGGGTCAATGCTGCCCCACAACCTCCAGATCCGTCCCAGTTCTGACGACCACAACCAATGTAGC
CATCTGACAAGTTGAGCCACAAGTTCTCCTGCTTATCACAGTCTGCTGCTTGACATTTCCACGCCGAAGGGTTCGACGCAATGTGCGGTGGGTTCGGGAC
TTGAATGAGGTGTTCGGCGTACTTGGTAGGCTCGAGTTCCTCCTGCCAGGACGCTACTTCTTCGGTTACCGTGTTCCCCGCGTGACTGAGCACAGCCTCG
GCTGCTTCTTTGAGCTTAGACGGGAGACTGGGGGAGTCTAGAGCTTCCCGGGCGAGTTCATGCTGGTCTGGGCCCAGTGAAACGATATAGAAAGTCTTTT
CAAGCTCGAATTTGTCTTTTACGGACGCTGCGAAGCCCCCAGCGCCACCAATAGCGAGCTTTGTGGGGATTTCTTCGGTACTTGAAGAGGATGAAGCCTT
AGGCTTGCGTGTGTGCTGCTGGTGCAGGTAGACGGCCGGAGTTTCGCTGCGATCGAACACAAGATACGAGGCTCCGTACGAGAGGAAGGAGCGCAGGTTC
GTGTAGAGACCCGAGGGGGAGAGAGCGGAGTCGAAGGAGAAAATGCACTCGTCACGGTACACGCGATCCGAAGCCCGTGCCACGCGAACAAGCGAAGCCG
CGGAGGATAGAGAAGCTTTCGTCATTTCTTTGTAGTGAAAAAGATATTCTACAGATTCGCGTACGAAACATAATATATGTAAATACTTTTACCTGCGAGC
CTATTCTACACATATCTACAAAGGATTTACCATTTCACTCGTCATGGAGGGACCAAAGCCAAGTCTTACGAGGTGTTTCGTCGACTTCACAGCAGCCGTC
AACAAATAATACTGCCGCTACATTTTTTTCTGTCGTGTTTGCTACGAAGTATGTATCATTTCTTCTTCGTCGCCTGCGTTTGTTTAATTCAGCATGGCTA
TTGTTGCTGTGGTGGGCGTGGTCGGGGTACCGCCCTCTGCATTGAGCACTGCCATCTCGTCCTGAGCGCGACGCAGCACCTTTTGAGCGTTGGCCGTGAT
GACCGACTTGGCCGGGTCGCCGTTGAAGATGCGCGAGTTGTTGACGATCAGCTCCAGGTCCTTGACAAACTCACGCATCGAGTCGTACTCCTTGGCCTCA
ATCTTGCGCTGAATCGTGCTCAGATCCATAGGCTGCTTGACAATCTGGTAGTAATTCTGGACACTGCTGGCATCCACCGGCACGCGGAAGAGTTCGCTCT
CCGGCATTTCGAGCAGCCGTTGCACAACCATCTCCAGAGCGTTATTGACGTGCTCCACGGGCATACGCGAGCGACTCTGCTTGATGGCGCCCTTCGCATA
GGGTCTCTTGTACAGCTCTGCCTGCTCACGCACCTCCATTTCTCGCTTGCGCTTCTTTTCTGCGTTGTGCTTGCGTGCACCCTCACGCAGCTCCGCCAGG
TTCACGGTGATCTTGGTACTCGAGTCGCCACCGGTGATGACCGACGGAGACTTCTTCATCTTGAGCTTCAAAGGTTCCGCGAGCATAGCGTTCGCTTGCT
TCTCAGAAAAAGCCCCCGACTTCTTTGAACGAACTTCATCAGCCATGTACAGCGGACAACTGCGGTTGGTGCGCATGTGCCCAACCTGTAGACACTGCGT
ACAGCGAATAACCCCCTTCCCACTCCCATCGTCAGCGTCGTCGCCATCAGCGCCATCCGCAGACTCGCCCTTCTTCAGCATTTCTTGGTATCCTTTGTTC
TGCGCCTCAGTCTTCGCCAGTTGCTTCAGTTCTTCTTGCAGCTGTTTGCGTCTCTTAGCCTTGTCCAGCAAACTCCCGTCATCCTCCAATGCGAGCATGC
GTTTACGCTTCCGAAGCTGGTTGCGCTCATCAGACTTCTGTTGACGGTCCTTGCGCTGCTGCATCGCGCGGAATCGGGCTACCAGTTTATCATCCACGAT
AAACTGGACGCGGACATTCTCGCTGCCGTCCTCTTCAATAGTCCGCACGACACGCTTTAGCACCTTGCGGCCGGGAATTTTCTTTGACGCACTTGGTGGC
TCCGACGGGACTGGTGTGCGACTGCCATGCGTTGGTGAGGACACTCGAGACAGCTGACCCGTGGGTGTTGCCAGCGCAGACGACACGGTTGAGCCGCCAC
GAGACATCATGTTGGATCGTGCCCCGAAGCCCGAGGCTGAAGAAATGCCACTCGCCCCAGTGCCACCCTCTTTAATTCCACTTGCACGCAGCTGGTTACG
CAAGCCGTTGGTGTCCACATCAGGACGACGCACAGCACTCGTCGGTTTGGCGTTCGCACTGGTTCCAGTGTCTTCGTTCATCTCTTCCATCAGGCGACGC
AGCTCCACAGCGTCTTCCCGCTCTGCAAGCACTTCCTTGGAGCGGTTGAGACCTCCACCACCACTACGGAACAAATTCTTCGGGCCGCGTTTAGTATCTG
TGCCTCCCAAGATGTCAGCCTCGACATCCGCACCCAGTTCGTCCAGCTCGTCATCGCCATCAGACTCTTCATCCGACGAAAATGTCGTCTTCGTGGAGCT
CAGCACATCCATTTGACGCTCGTAGATCACGTCACACTTCTTGCGGTACTCTTGCTGCTGCGCAGAAAGCGACTTACGCGCGCCACGAGCGAATTTGCTC
AAACTACCAGCCACACCGTGGGCTGTAGCACGACTACTGAGTTCACGCACCATATGAATTCGATCCCAACGGCGAAGTTTCTTGATATCCGCGTCAGCCA
GACCCAGATTGCGCAGCACATCACCTGCCTCTTTCATCTTCAGCTTACGCAAATCAGCAGTCGTACCGGTGACAGCAGCCACGGCTTTTTGCACCGCTGC
AGTCTCCGCACTAATCTTGCTCTCAGCTGTCGGAGCTGCATCTTCCTCTCCGTCTTTCTTCTTGGCGCGGGACTGAGGCACACGGACGAAGCTAAAGCCT
TCACCACGACCGGTGGGGTCACCAATGCCACCAAGTTGCAGCATGCCAGAGCCTTTACCTTGTAGATGGCACTCGACGTAATTGTTCGTCAAGTTCCAAG
GCGTAAGCTGCAGCTGCTCGTTAATATAACGAGCGACTTGAATATCTTTCTCGAGCTTGCGCACCACCGGGTCCTTCTTCCAGAGTTCCGCCTGAGTCTT
CTCCCGTGCTCGTCTCTCGAGATTGGCAGGCACAAGACGTGTCGACAATGCATTCTTGCGCAGTTCCAGACGTCGGATCAAATGGTTGATGGCTCCATTC
ACGCCAGAAGGGGTGAAGAGCTTGGTCAGTCCGATATCGAGTAGCCGTCTGTGACCAGACATCATACTCTCGTAAAGACAGACGCTCTCAGGCGGGATGC
TAGCACGGATCTCTTCCTCGCTCTGCAGCTGCGAAACCGGTTTCTTCTTCCACCAACCTGAATCATTACCGCCACGCTCAAATGTAGCCACCTCCTTCAT
TCGCTTACGGATAGCGGTACCCGACTGATTCGGGAATGCACGCGCAATGTCCTCGATCTTAAGTCGTTCTCCATCGCTCGCTTTCTTGAATAGACGAAGA
ATGTGAAACGACATGTACGGGCGGATAAACTCGTTGGCACTTCGAGAGTTCGGCGCTGGGACTTCGATTTGAGGCTCAATTTGGCCTGCGACGAAGACCT
CAGGCAGCTCCATGATGTATACCGTAGTCTTCGGAACTCCAAGACCGCCCGATTTGTCTGCTGCAGCTCCCTTCTTACCCTTCGTGATCGAGCGACACAT
CAAAAAGATATCCGAGTTGTTGCGCTCGCGTGCATCCGGACTTGCAGCAAACGGAATCGTCGGCTTGTGCGGAAAAAGTGGCACCTTGTAGAGCTTCGAG
TTAAGAGACGTCACTACTCGTCCCGGAGGAATGTCACCGACAAATGGAGACTCATCGTGGTCGCCAAGCGTAATGACTTGGCCCATCTTCATATCTGGTG
GCTTTGGACGTGTCTTGCGAGCCTTCTTCTTACCCAGAATTCCCAACCCAGCCGATGTATCCTCTGGAGGTCGCCAGTAGTGGAGGATTCGAGACGCCAT
GCCCGGGTTTGACAGCATCGGCGGGCGCTGTTCTGTGTACTCGATCAGAATTAACTTCCCGCCAGCAGTCGGATTCAAGTCGGAACTTTTCTTTATCTGT
GTAACCATGGCACTTTCCTCTTGTGGAGCCATTTTCGCAGCACCTGGAGGCGGTGGCAAGAACTCCAGCCGTTCGTTGATTTTGAACTTACCGCGCGGTC
GGTGAAAGTCGCGCAGTTTTGTCTTGGGGAGTTCTGGCTTCGTGAGCGAAAGCTTCATAGCTGGCAGCGAGTGGTGCACATAGCCAATGTTCTTCACCAC
ACGAGTGTCCTTCGACTTCTTGCCACTTCCTTCGGTACCCAATCGACCTTCAGCCGTCTCCTCGCCGAACTCAAGGTTGCCCATTACTTCGTCAATACGC
TGTTTCTTCTCAATCCGCTGCTTGTCAAGCTGCGCCAGACGCTGCTCAGCAGCTCCCAGCTTTCGTTCAGGAATACGCAAGGTCGGACGCACATCTTCCA
TCTCCGGGACCGAATAAATGAGCGACGCATCGTTGTCATCCAGCACAAGTTTGCTTTCGGGCATGTCCTGGGTCGATTTCCACCCAATAGCAGTCACCCA
CGAGTCGTCCTGTAGCTGCTTATTCAGTGGACATGGGAGCGTTGGCATCTCATTTTCCTGAGCCTTCTCGTCTTGCTTCTTTTCTTTTGATGAATCCTCT
AGCTCCCAACGGTAATTCCTGGGCTTCGTCATGTCAAAGTTCTCCCCACTGATGGTCGACACAGGCGTCTCCTGTCCTCTCGCCGCGCGTAGCTGCTTGT
ACGTCTGGAATCCACCATCACTCTTCTCTGAGACTTTCGTCCATCTATTACCTTTTACTGGAGCCCTCTTCTCTTGAGCTACGGTGACTCCTCCGACCGA
GTCCTCCACTTCCACACCTCTGTCTTCCTCATCTTCTCGTTTAGAATCAGCGTTGAAGTCGATACCCCAAATAATATTCTCCTCCCATCGAAGCTGCTGC
ACTTTGTGGTACTGCGCGTCAGTTTCCTCATCCGAGTCGGCGAGTGCACCACTTCTTCCACCCGTGGCTGCCATCATGACGAACGGCGTGGTAGACGACA
CCAGGAAGCGACGCATCGGCTTTCCCTTAGCCTCTGCGCTTCTAGCAGGATGAAGGTGCATAGAATGCTCCTTTCCTGCAGCGTTCTCTGCACCTCCGGC
CTCCTGCGTCGTCAGAAGCTGCTGTAGCTGGTCCGGGGCGAATCGCAAAGCTGGTACTTCTGCTGTCGAGCTCTGATTTTGGCTCTGCGTCCTGCGTTGA
GCTTTGACCTCTTCTAATTCTTTTTCCAACCCCTGTAGCGTCGCAAAGACCTCTGTGTCGCGCGAAGATCGCTGGTACAGAGCGGCGAAGTCGACGTGCT
CCAATCGAGCCTTATTTTGCAGTGAAGACACGTCGGTAGTGGGCACAAGGGGTAGTATCGGCTTGCTAAGGGACATATCTTCGCATAAAGACGATGCGGG
CTCCTCCGTGGCCCCTGTGGGGCTCTGTAGAGCGCTCTTGAGTGGCGTAGAAGCCAGCATCATACTGTCTTGTTGGGTAGGCGCCATTTTGCCAACTGAC
CAGGTCAGATTTAATGTCGCGCGAAGACGATTGTCGCTTGAACGAGTGATGGTCAGTTTGGCATTTGTATCGATCAAAATTTGATTCATGGCTACATTTG
CTGTATTTGAGTCTTGCGTCAATAATGCAGCGGCTGAAGTTGGATGAGACAGCGCTGGACTTGTTCGCACGGAGGCCGACTCGCAGCTTCTCGACGGGTT
TAAACTTTATCGACGCGGCTACAACAAAACCTAATGTAGGAGAAACTGGATATCGACCACGACAAGTTGTAGAGCTCTGTGGGGCGAGTGACACTCCCAA
GACTCAAGTGCTGGAGCATGTCGTGGCAGCTTTTCTGACTAAAAGCGCAGCAACGAGTGACCAGGCAGGGAAAGAACGCGTTTTTATCTTCGACCATGAA
GGTGAATTGTCTTCAACGCGGTTGGCGAAACTAGTGGCCCATAAATTGGCTGGGAGCAAGTGGGAGAATGCGTTGGAGGGGGCACTGGCTAGAGTGCAGA
CCTGCTGCTGTCGAGACTCGTTCCAGTGGCTGGCAACGCTGAATCACATTCACTTTCAATTACTAGAAGCAGCTCCAGCACGTGAGTTACAGTGGGAGTG
GAGGTTGGAGGAGGGTCGCTAATATTTTGGTGGTGGGTCTGATTACAGCTTTGATGCTGGTGTTCAACTGCGTGGGGTCATTCCATGCCATTGACAAGGT
ATGATAAATTGCAGTGAAATGAAATAGAATGTAAACTTCTAATGTGAATCGTCACTACAGATGACAGCGAAGAGTGTCGGCGAGGGGCTAGCGCTTTCCG
AACAAGTATTTATTTTTTTGAAACAGTTTATCCGGCATCACTCGCCGATAGTTTTTGCAGCTAAGGAGACGGCAAGTACGTGCAAACCCTATATCCAGGA
TGTAAATGTCGAGTGCGCTGATGCCGAGTGCGAATGGTGCTTGACGTGACAGAGAGCACAAGGGCACAATGGGAACACGCTGAGTATCTGCCTTCGTCGT
GGACTAGCCAAGTCTCAAAACGAATTTTGCTTCGAATACCGCCACCACCAATACTCCCAAGAGAAAGGTACAATTTTAACACCTTCACCCTGTCATACCT
TGCTTTCTAATCAGAATTGTCATAGTTACAAACTAGAGAAGAAAGTCGAGCTTGACGACGACAGCAACACCCGATTCGAGGCCAAGTGTATCGCCGCTGG
AGAGAGGTAAATCTCCTACTGCAGTGTACAGTAGTACCTTAGTGTTACTTGAGTACGAATGTAAAGCCGTTCTGACGTGACGTTGTGCTTCCTCCCAGCC
GAGTATTCATGTGCCACGTAGATGAAGGTTTCATTTTCTCAAAATTATTCGGCGACGGAAAGCCGTCGCTCATGAAATGATACTTAGTACAAGTACCCAA
TCTGTCGGACTCAACTTTAGCAGTGGAATGACTCCGGTGCGTATGACGCGTTATAACTTAGACGACTTTTGGTCTCAATAAGCGCTAGCTGCGGATTCCT
TGATACCGCAGATGAATCGTGGCTTAATGCTTCCCATGCAGGCAAAATATGGCGAGTAATCCGCTCATCGTTCAAAGCTCGAACTTTGACCTTCGAAGGT
GTTGGTGCTGGAGTGATCTCAGAGGTACAACCAATATGTTCTCTGAAACATTTGAAGATACTGGCACCTGATGCACAAGCTCTCAAGACATCCACATTGC
TATCGACACTATCCGAATCCACTGCGGGGCCGCCCAGTGTGTGGTCAAATAAGCTCACGATACCCGAACAATGACGCTCTGGACATGGCTCCACCTTTCT
ATCCACCACAGTTCCTATAACAACAAGATTGTCTTGTGGAATGGCAATCCAGTGTAGCTGCGTGTGCACGAAGCACTCAAAGCCATCGGGATAAACGGCT
TTCAAGACCCCAAGCGCTTTCAGTACACTGGGTTTGTAGTACAGTTCGTCGTTTTCCCAAATGTAGCCACTCAGCAGAATCAGCTTACTCCTTGCTCCCA
GTGCAGCATCGACCGAGCACATTTTCGTCAAAACCTGGAGAGTACCGAACTGTAATTTCACAAACAAGATGGCTCCGATGACTCTTGTGGCAACGATGAT
ACTCAGACAACCAGCCGCCAGCACAATATGACCCACGAGTCCCATCACGTAATGAGAGACCACTTCTGCCGCTGGCTCTGTGTCCTGTAAATGCGACCGG
CTTAAGGACGTCAGATAGTGTTGCAACACTCCAGCTGTGATCAATTCGCCGACGAGAACTGTCTCGTAGTTAAAGAGCAATCTTTTGGCTTGGCAGCGCA
TCTTCTCACTCATCCAGTTCATTGTCTCCACCATTTCAAACAACATGGACATAACACCA